DNASU Plasmid Repository • 480.965.5697 | Email

CSNK1A1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CSNK1A1
Gene Name:  casein kinase 1, alpha 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH009428.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00006002

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1014nts         Open reading frame : 1 to 1014
Reference Sequence Alignment

ATGGCGAGTAGCAGCGGCTCCAAGGCTGAATTCATTGTCGGAGGGAAATATAAACTGGTA
CGGAAGATCGGGTCTGGCTCCTTCGGGGACATCTATTTGGCGATCAACATCACCAACGGC
GAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAG
AGCAAGCTCTATAAGATTCTTCAAGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGT
CAGGAAAAAGACTACAATGTACTAGTCATGGATCTTCTGGGACCTAGCCTCGAAGACCTC
TTCAATTTCTGTTCAAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATG
ATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGAT
AACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTG
GCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAAC
CTCACTGGCACTGCCCGATATGCTAGCATCAATGCACATCTTGGTATTGAGCAGAGTCGC
CGAGATGACATGGAATCATTAGGATATGTTTTGATGTATTTTAATAGAACCAGCCTGCCA
TGGCAAGGGCTAAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAG
ATGTCCACGCCTGTTGAAGTTTTATGTAAGGGGTTTCCTGCAGAATTTGCGATGTACTTA
AACTATTGTCGTGGGCTACGCTTTGAGGAAGCCCCAGATTACATGTATCTGAGGCAGCTA
TTCCGCATTCTTTTCAGGACCCTGAACCATCAATATGACTACACATTTGATTGGACAATG
TTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCCAGTGGGCAGGGTCAGCAGGCCCAA
ACCCCCACAGGCAAGCAAACTGACAAATCCAAGAGTAACATGAAAGGTTTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1139
Start on reference sequence 126
Mutations:
None
Discrepancy:
t42a; c133g,L45V; a936c
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CSNK1A1
Symbol Nomenclature : CSNK1A1
SYNONYM : CK1; CK1a; CKIa; HLCDGP1; PRO2975
Designation : CKI-alpha|casein kinase I isoform alpha|clock regulator kinase|down-regulated in lung cancer
Full Nomenclature : casein kinase 1, alpha 1
GENEID : 1452
GI : 60812347
GenBank Accession : AY893171
HGNC : 2451
MIM : 600505
Vega : OTTHUMG00000163463
Target GenBank: NM_001892

 

Reference Sequence Alignment

  

HsCD00006002        ATGGCGAGTAGCAGCGGCTCCAAGGCTGAATTCATTGTCGGAGGGAAATATAAACTGGTA
NM_001892.5         ATGGCGAGTAGCAGCGGCTCCAAGGCTGAATTCATTGTCGGAGGGAAATATAAACTGGTA
NM_001025105.2      ATGGCGAGTAGCAGCGGCTCCAAGGCTGAATTCATTGTCGGAGGGAAATATAAACTGGTA
                    ************************************************************

HsCD00006002        CGGAAGATCGGGTCTGGCTCCTTCGGGGACATCTATTTGGCGATCAACATCACCAACGGC
NM_001892.5         CGGAAGATCGGGTCTGGCTCCTTCGGGGACATCTATTTGGCGATCAACATCACCAACGGC
NM_001025105.2      CGGAAGATCGGGTCTGGCTCCTTCGGGGACATCTATTTGGCGATCAACATCACCAACGGC
                    ************************************************************

HsCD00006002        GAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAG
NM_001892.5         GAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAG
NM_001025105.2      GAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAG
                    ************************************************************

HsCD00006002        AGCAAGCTCTATAAGATTCTTCAAGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGT
NM_001892.5         AGCAAGCTCTATAAGATTCTTCAAGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGT
NM_001025105.2      AGCAAGCTCTATAAGATTCTTCAAGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGT
                    ************************************************************

HsCD00006002        CAGGAAAAAGACTACAATGTACTAGTCATGGATCTTCTGGGACCTAGCCTCGAAGACCTC
NM_001892.5         CAGGAAAAAGACTACAATGTACTAGTCATGGATCTTCTGGGACCTAGCCTCGAAGACCTC
NM_001025105.2      CAGGAAAAAGACTACAATGTACTAGTCATGGATCTTCTGGGACCTAGCCTCGAAGACCTC
                    ************************************************************

HsCD00006002        TTCAATTTCTGTTCAAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATG
NM_001892.5         TTCAATTTCTGTTCAAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATG
NM_001025105.2      TTCAATTTCTGTTCAAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATG
                    ************************************************************

HsCD00006002        ATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGAT
NM_001892.5         ATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGAT
NM_001025105.2      ATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGAT
                    ************************************************************

HsCD00006002        AACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGT-----------------------
NM_001892.5         AACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGT-----------------------
NM_001025105.2      AACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTGTTTAGAATCTCCAGTGGGGAAG
                    *************************************                       

HsCD00006002        ------------------------------------------------------------
NM_001892.5         ------------------------------------------------------------
NM_001025105.2      AGGAAAAGAAGCATGACTGTTAGTACTTCTCAGGACCCATCTTTCTCAGGATTAAACCAG
                                                                                

HsCD00006002        -TATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACAC
NM_001892.5         -TATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACAC
NM_001025105.2      TTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACAC
                     ***********************************************************

HsCD00006002        ATACCATACAGAGAAGATAAAAACCTCACTGGCACTGCCCGATATGCTAGCATCAATGCA
NM_001892.5         ATACCATACAGAGAAGATAAAAACCTCACTGGCACTGCCCGATATGCTAGCATCAATGCA
NM_001025105.2      ATACCATACAGAGAAGATAAAAACCTCACTGGCACTGCCCGATATGCTAGCATCAATGCA
                    ************************************************************

HsCD00006002        CATCTTGGTATTGAGCAGAGTCGCCGAGATGACATGGAATCATTAGGATATGTTTTGATG
NM_001892.5         CATCTTGGTATTGAGCAGAGTCGCCGAGATGACATGGAATCATTAGGATATGTTTTGATG
NM_001025105.2      CATCTTGGTATTGAGCAGAGTCGCCGAGATGACATGGAATCATTAGGATATGTTTTGATG
                    ************************************************************

HsCD00006002        TATTTTAATAGAACCAGCCTGCCATGGCAAGGGCTAAAGGCTGCAACAAAGAAACAAAAA
NM_001892.5         TATTTTAATAGAACCAGCCTGCCATGGCAAGGGCTAAAGGCTGCAACAAAGAAACAAAAA
NM_001025105.2      TATTTTAATAGAACCAGCCTGCCATGGCAAGGGCTAAAGGCTGCAACAAAGAAACAAAAA
                    ************************************************************

HsCD00006002        TATGAAAAGATTAGTGAAAAGAAGATGTCCACGCCTGTTGAAGTTTTATGTAAGGGGTTT
NM_001892.5         TATGAAAAGATTAGTGAAAAGAAGATGTCCACGCCTGTTGAAGTTTTATGTAAGGGGTTT
NM_001025105.2      TATGAAAAGATTAGTGAAAAGAAGATGTCCACGCCTGTTGAAGTTTTATGTAAGGGGTTT
                    ************************************************************

HsCD00006002        CCTGCAGAATTTGCGATGTACTTAAACTATTGTCGTGGGCTACGCTTTGAGGAAGCCCCA
NM_001892.5         CCTGCAGAATTTGCGATGTACTTAAACTATTGTCGTGGGCTACGCTTTGAGGAAGCCCCA
NM_001025105.2      CCTGCAGAATTTGCGATGTACTTAAACTATTGTCGTGGGCTACGCTTTGAGGAAGCCCCA
                    ************************************************************

HsCD00006002        GATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCATCAATAT
NM_001892.5         GATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCATCAATAT
NM_001025105.2      GATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCATCAATAT
                    ************************************************************

HsCD00006002        GACTACACATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCC
NM_001892.5         GACTACACATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCC
NM_001025105.2      GACTACACATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCC
                    ************************************************************

HsCD00006002        AGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAATCCAAGAGT
NM_001892.5         AGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGT
NM_001025105.2      AGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGT
                    ***************************************************:********

HsCD00006002        AACATGAAAGGTTTCTTG
NM_001892.5         AACATGAAAGGTTTCTAA
NM_001025105.2      AACATGAAAGGTTTCTAA
                    ****************:.

Pathways

NCI : Degradation of beta catenin
NCI : FoxO family signaling
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : Noncanonical Wnt signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : p53 pathway
Panther : Hedgehog signaling pathway
Panther : Parkinson disease
Panther : Wnt signaling pathway
Reactome : Beta-catenin phosphorylation cascade
Reactome : Degradation of beta-catenin by the destruction complex
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : TCF dependent signaling in response to WNT
Reactome : disassembly of the destruction complex and recruitment of AXIN to the membrane

Clone

Cloning Information : 9428
HIP Master Clone ID : 13337
Original Clone ID : FLH009428.01L

Organism


TAX_ID : 9606
Species Specific ID: 1452

Genome

Chromosome : 5
Map Location : 5q32
Ensembl : ENSG00000113712

Reagents

Labome : CSNK1A1-antibody