DNASU Plasmid Repository • 480.965.5697 | Email

Heavy chain (Homo sapiens) & Light chain (Homo sapiens) in pFab007

TOP

Explanation of Terms


Gene 1: Gene Symbol:  Heavy chain
Gene Name:  Heavy chain
Gene 2: Gene Symbol:  Light chain
Gene Name:  Light chain
Sequence             
Original Clone ID: anti-ZFYVE20-RAB-C15
Keyword: anti-ZFYVE20-RAB-C15 recombinant antibody fab fragment
Species: Homo sapiens
Type: cDNA
Vector Name: pFab007               Format:  FUSION
Source: Recombinant Antibody Network
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Recombinant Antibody Network
The University of Chicago
Protein Capture Reagents Program
HsCD00601566

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 759nts         Open reading frame : 1 to 759 & 1 to 724

ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAAC
GCGTACGCTGAGATCTCCGAGGTTCAGCTGGTGGAGTCTGGCGGTGGCCTGGTGCAGCCA
GGGGGCTCACTCCGTTTGTCCTGTGCAGCTTCTGGCTTCAACGTCTATTCTTATTCTATA
CACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCATATATTTCTCCTTAT
TCTGGCTCTACTTCTTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACA
TCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTAT
TATTGTGCTCGCTACTACATGCCGGGTTTGGACTACTGGGGTCAAGGAACCCTGGTCACC
GTCTCCTCGGCCTCCACCAAGGGTCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGC
ACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTG
ACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTA
CAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGC
ACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTCGACAANAAA
GTTGAGCCCAAATCTTGTGACAAAACTCACACATAGTGC



ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAAT
GCCTATGCATCCGATATCCAGATGACCCAGTCCCCGAGCTCCCTGTCCGCCTCTGTGGGC
GATAGGGTCACCATCACCTGCCGTGCCAGTCAGTCCGTGTCCAGCGCTGTAGCCTGGTAT
CAACAGAAACCAGGAAAAGCTCCGAAGCTTCTGATTTACTCGGCATCCAGCCTCTACTCT
GGAGTCCCTTCTCGCTTCTCTGGTAGCCGTTCCGGGACGGATTTCACTCTGACCATCAGC
AGTCTGCAGCCGGAAGACTTCGCAACTTATTACTGTCAGCAATACTACTGGGTTCAGCAG
CTGATCACGTTCGGACAGGGTACCAAGGTGGAGATCAAACGAACTGTGGCTGCACCATCT
GTCTTCATCTTCCCGCCATCTGATTCACAGTTGAAATCTGGAACTGCCTCTGTTGTGTGC
CTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTC
CAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGC
CTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAAAAACATAAAGTCTACGCCTGC
GAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGT
TAAT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pFab007
Synonyms: None
Description: Recombinant antibody expression vector with STII periplasm export sequences; ampicillin resistance in bacteria
Comments: None
Size (bp): 5214
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, with tag/fusion/marker
Author Name: University of Chicago
Recombinant Antibody Network
Publications: None
Vector Map:         Vector Sequence:
Sequence:



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 4336 4128
primer forward primer For heavy chain CDRs: FabHCupF: 5 GGACGCATCGTGGCCC 3 1571 1586
primer site forward light chain CDR: FabLCupF: 5 CTGTCATAAAGTTGTCACGG 3 688 707
promoter T7 T7 promoter 3115 3142
secretion signal sequence STII STII periplasm export sequence 804 873
selectable marker AmpR ampicillin resistance 4226 4885
ssDNA origin f1 f1 origin 135 441
tag V5 V5 epitope tag 2428 2469

 

  • Protein
  • Clone

Protein

PCRP Binder Details : anti-ZFYVE20-RAB-C15

Clone

Cloning Information : 662839
Original Clone ID : anti-ZFYVE20-RAB-C15