DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pCMV(WT)

TOP

Explanation of Terms


Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: WISP12-91
Type: No insert
Vector Name: pCMV(WT)              
Source: Sundquist Lab
Description: Mammalian expression vector with a CMV promoter; ampicillin resistance in bacteria, neomycin resisatance in mammalian cells; restriction enzyme cloning
Comments: None
Publications: None
Authors: University of Utah
Eiji Morita
Jun Arii
Wesley I. Sundquist
Devin Christensen
Jorg Votteler
EvNO00601609

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  neomycin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pCMV(WT)

pCMVWT in advanced viewed

Synonyms: WISP12-91
Sequencing Primer: Forward:  pcDNAF
Reverse:  pcDNAR
Description: Mammalian expression vector with a CMV promoter; ampicillin resistance in bacteria, neomycin resisatance in mammalian cells; restriction enzyme cloning
Comments: Empty vector Sundquist Lab internal database number = WISP12-91. Restriction enzyme cloning can be used with this vector - e.g. Xho1, Kpn1 works well
Size (bp): 5478
Parent Vector: None
Properties: mammalian expression, multiple cloning site
Author Name: University of Utah
Eiji Morita
Jun Arii
Wesley I. Sundquist
Devin Christensen
Jorg Votteler
Publications: PMID: 22877307
Title: Attenuated protein expression vectors for use in siRNA rescue experiments

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin 3705 4387
primer reverse primer Reverse 3' sequencing primer pcDNAR AACTAGAAGGCACAGTCGAGGCTG 1066 1089
primer T7 T7 primer 863 882
primer forward primer pcDNAF forward 5' sequencing primer AGAGAACCCACTGCTTACTGGCTTATC 831 857
promoter CMV Wildtype CMV promoter 210 830
selectable marker NeoR Neomycin resistance (mammalian cells) 2186 2977
selectable marker AmpR Ampicillin resistance 4485 5144
ssDNA origin f1 f1 origin 1362 1668

 

Original Clone ID: WISP12-91
Species Specific ID: None
Target GenBank: None