DNASU Plasmid Repository • 480.965.5697 | Email

Light Chain (Homo sapiens) & Heavy Chain (Homo sapiens) in pSFV3

TOP

Explanation of Terms


Gene 1: Gene Symbol:  Light Chain
Gene Name:  Light Chain
Gene 2: Gene Symbol:  Heavy Chain
Gene Name:  Heavy Chain
Sequence             
Original Clone ID: anti-SCML2-RAB-C116
Keyword: anti-SCML2-RAB-C116 recombinant antibody fab fragment
Species: Homo sapiens
Type: cDNA
Vector Name: pSFV3               Format:  FUSION
Source: Recombinant Antibody Network
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The University of Chicago
Recombinant Antibody Network
Protein Capture Reagents Program
HsCD00604301

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 714nts         Open reading frame : 1 to 714 & 1 to 840

ATGAAATCCCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCC
ATGGCGTCCGATATCCAGATGACCCAGTCCCCGAGCTCCCTGTCCGCCTCTGTGGGCGAT
AGGGTCACCATCACCTGCCGTGCCAGTCAGTCCGTGTCCAGCGCTGTAGCCTGGTATCAA
CAGAAACCAGGAAAAGCTCCGAAGCTTCTGATTTACTCGGCATCCAGCCTCTACTCTGGA
GTCCCTTCTCGCTTCTCTGGTAGCCGTTCCGGGACGGATTTCACTCTGACCATCAGCAGT
CTGCAGCCGGAAGACTTCGCAACTTATTACTGTCAGCAATACTACTACAAACCGGTCACG
TTCGGACAGGGTACCAAGGTGGAGATCAAACGAACTGTGGCTGCACCATCTGTCTTCATC
TTCCCGCCATCTGATTCACAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAAT
AACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGT
AACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGC
ACCCTGACGCTGAGCAAAGCAGACTACGAAAAACATAAAGTCTACGCCTGCGAAGTCACC
CATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAA



ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAAC
GCGTACGCTGAGATCTCCGAGGTTCAGCTGGTGGAGTCTGGCGGTGGCCTGGTGCAGCCA
GGGGGCTCACTCCGTTTGTCCTGTGCAGCTTCTGGCTTCAACGTCTCTTCTTATTCTATA
CACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCATATATTTCTTCTTAT
TCTGGCTATACTTCTTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACA
TCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTAT
TATTGTGCTCGCTACTACTACTCTTACATGCATTACTACGGTGCTTTAGACTACTGGGGT
CAAGGAACCCTGGTCACCGTCTCCTCGGCCTCCACCAAGGGTCCATCGGTCTTCCCCCTG
GCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGAC
TACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCAC
ACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTG
CCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAAC
ACCAAGGTCGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCACACAGGAGGTTCT
GGCAGCGCCGGTGGCCTGAACGATATTTTTGAAGCGCAGAAAATTGAATGGCATGAATGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSFV3
Synonyms: ''
Description: Bacterial expression vector for recombinant antibody expression with a Tac promoter and C-terminal 6xHis tag; ampicillin resistance in bacteria
Comments: None
Size (bp): 6775
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, loxP, with tag/fusion/marker
Author Name: Structural Genomics Consortium
Publications: None
Vector Map:         Vector Sequence:
Sequence:



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 origin 1612 2231
gene fragment heavy chain 5625 6470
gene fragment light chain Light chain 4796 5506
promoter lac lac promoter 3171 3200
promoter lac 2 Second lac promoter 4497 4520
promoter tac promoter Tac promoter 4607 4635
promoter tac promoter 2 Second Tav promoter 4702 4730
recombination site LoxP Lox P site 4908 4938
reporter gene LacZ Lac Z reporter gene 2950 3109
repressor protein gene LacI Lac I 3249 4340
selectable marker AmpR ampicillin resistance 597 1457
selectable marker sacB Sac B gene allowing negative selection on 5% sucrose 4947 4882
ssDNA origin f1 f1 origin 29 335
tag His C-terminal 6xHis tag 6535 6615
trxn termination sequence TrpA TrpA transcription terminator 6657 6684

 

  • Protein
  • Clone

Protein

PCRP Binder Details : anti-SCML2-RAB-C116

Clone

Cloning Information : 664582
Original Clone ID : anti-SCML2-RAB-C116