DNASU Plasmid Repository • 480.965.5697 | Email

Heavy Chain (Homo sapiens) & Light Chain (Homo sapiens) in pBL166

TOP

Explanation of Terms


Gene 1: Gene Symbol:  Heavy Chain
Gene Name:  Heavy Chain
Gene 2: Gene Symbol:  Light Chain
Gene Name:  Light Chain
Sequence             
Original Clone ID: anti-SMARCE1-RAB-S18
Keyword: anti-SMARCE1-RAB-S18 recombinant antibody fab fragment
Species: Homo sapiens
Type: cDNA
Vector Name: pBL166               Format:  CLOSED
Source: Recombinant Antibody Network
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The University of Chicago
Recombinant Antibody Network
Protein Capture Reagents Program
HsCD00604334

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 780nts         Open reading frame : 1 to 780 & 1 to 756

ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAAC
GCGTACGCTGAGATCTCCGAGGTTCAGCTGGTGGAGTCTGGCGGTGGCCTGGTGCAGCCA
GGGGGCTCACTCCGTTTGTCCTGTGCAGCTTCTGGCTTCAACTTTTCTTCTTCTTCTATA
CACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCATCTATTTCTTCTTCT
TATGGCTATACTTATTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACA
TCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTAT
TATTGTGCTCGCACTGTTCGTGGATCCAAAAAACCGTACTTCTCTGGTTGGGCTATGGAC
TACTGGGGTCAAGGAACCCTGGTCACCGTCTCCTCGGCCTCCACCAAGGGTCCATCGGTC
TTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTG
GTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGC
GGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTG
GTGACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAG
CCCAGCAACACCAAGGTCGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCACTAA



ATGAAATACCTATTGCCTACGGCAGCCGCTGGCTTGCTGCTGCTGGCGGCCCAGCCGGCC
ATGGCGTCCGATATCCAGATGACCCAGTCCCCGAGCTCCCTGTCCGCCTCTGTGGGCGAT
AGGGTCACCATCACCTGCCGTGCCAGTCAGTCCGTGTCCAGCGCTGTAGCCTGGTATCAA
CAGAAACCAGGAAAAGCTCCGAAGCTTCTGATTTACTCGGCATCCAGCCTCTACTCTGGA
GTCCCTTCTCGCTTCTCTGGTAGCCGTTCCGGGACGGATTTCACTCTGACCATCAGCAGT
CTGCAGCCGGAAGACTTCGCAACTTATTACTGTCAGCAATACTGGTTCCCGGTTTTCTAC
CCGATCACGTTCGGACAGGGTACCAAGGTGGAGATCAAACGAACTGTGGCTGCACCATCT
GTCTTCATCTTCCCGCCATCTGATTCACAGTTGAAATCTGGAACTGCCTCTGTTGTGTGC
CTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTC
CAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGC
CTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAAAAACATAAAGTCTACGCCTGC
GAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGT
GGTGGTTCTGATTACAAAGATGACGATGACAAATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Expressed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pBL166
Synonyms: ''
Description: Recombinant antibody bacterial expression vector with C-terminal flag tagged light chain; ampicillin resistance in bacteria.
Comments: None
Size (bp): 7287
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, with tag/fusion/marker
Author Name: Recombinant Antibody Network
Publications: None
Vector Map:         Vector Sequence:
Sequence:



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 origin 1224 1843
gene fragment ROP ROP ORF 2258 2449
gene fragment light chain Light Chain with N-terminal PelB signal sequence 5317 5382
gene fragment heavy chain Heavy chain 6179 6958
repressor binding site lac operator lac operator 5248 5275
repressor protein gene LacI LacI 3761 4852
selectable marker AmpR ampicillin resistance 209 1069
tag Flag C-terminal Flag tag of the light chain 6037 6060
trxn termination sequence T7 term T7 transcription terminator 6972 7100

 

  • Protein
  • Clone

Protein

PCRP Binder Details : anti-SMARCE1-RAB-S18

Clone

Cloning Information : 664615
Original Clone ID : anti-SMARCE1-RAB-S18