DNASU Plasmid Repository • 480.965.5697 | Email

E2F2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  E2F2
Gene Name:  E2F transcription factor 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH008588.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000612

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1314nts        
Open reading frame : 1 to 1314
Reference Sequence Alignment

ATGCTGCAAGGGCCCCGGGCCTTGGCTTCGGCCGCTGGGCAGACCCCGAAGGTGGTGCCC
GCGATGAGCCCCACAGAGCTGTGGCCATCCGGCCTCAGCAGCCCCCAGCTCTGCCCAGCT
ACTGCTACCTACTACACACCGCTGTACCCGCAGACGGCGCCTCCCGCAGCGGCGCCAGGC
ACCTGCCTCGACGCCACTCCCCACGGACCCGAGGGCCAAGTTGTGCGATGCCTGCCGGCA
GGCCGGCTGCCGGCCAAAAGGAAGCTGGATCTGGAGGGGATTGGGAGGCCCGTCGTCCCT
GAGTTCCCAACCCCCAAGGGGAAGTGCATCAGAGTGGATGGCCTCCCCAGCCCCAAAACC
CCCAAATCCCCCGGGGAGAAGACTCGGTATGACACTTCGCTGGGGCTGCTCACCAAGAAG
TTCATTTACCTCCTGAGCGAGTCAGAGGATGGGGTCCTGGACCTGAACTGGGCCGCTGAG
GTGCTGGACGTGCAGAAGCGGCGCATCTATGACATCACCAACGTGCTGGAAGGCATCCAG
CTCATCCGCAAGAAGGCCAAGAACAACATCCAGTGGGTAGGCAGGGGAATGTTTGAAGAC
CCCACCAGACCTGGGAAGCAGCAACAGCTGGGGCAGGAGCTGAAGGAGCTGATGAACACG
GAGCAGGCCTTGGACCAGCTCATCCAGAGCTGCTCTCTGAGCTTCAAGCACCTGACTGAG
GACAAGGCCAACAAGAGGCTGGCCTATGTGACTTACCAGGATATCCGTGCTGTTGGCAAC
TTTAAGGAGCAGACAGTGATTGCCGTCAAGGCCCCTCCGCAGACGAGACTGGAAGTGCCC
GACAGGACTGAGGACAACCTGCAGATATATCTCAAGAGCACCCAAGGGCCCATCGAAGTC
TACCTGTGCCCAGAGGAGGTGCAGGAGCCGGACAGTCCTTCCGAGGAGCCTCTCCCCTCT
ACCTCCACCCTCTGCCCCAGCCCTGACTCTGCCCAGCCCAGCAGCAGCACCGACCCTAGC
ATCATGGAGCCCACAGCATCCTCAGTGCCAGCACCAGCGCCAACCCCCCAGCAGGCCCCA
CCGCCTCCATCCCTGGTCCCCTTGGAGGCTACTGACAGCCTGCTGGAGCTGCCGCACCCA
CTCCTGCAGCAGACTGAGGACCAGTTCCTGTCCCCGACCCTGGCGTGCAGCTCCCCTCTG
ATCAGCTTCTCCCCATCCTTGGACCAGGACGACTACCTGTGGGGCTTGGAGGCGGGTGAG
GGCATCAGCGATCTCTTCGACTCCTACGACCTTGGGGACCTGTTGATTAATTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1742
Start on reference sequence 429
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : E2F2
Symbol Nomenclature : E2F2
SYNONYM : E2F-2
Designation : transcription factor E2F2
Full Nomenclature : E2F transcription factor 2
GENEID : 1870
GI : 61366376
GenBank Accession : AY890914
HGNC : 3114
MIM : 600426
Vega : OTTHUMG00000003223
Target GenBank: NM_004091

 

Reference Sequence Alignment

  

HsCD00000612      ATGCTGCAAGGGCCCCGGGCCTTGGCTTCGGCCGCTGGGCAGACCCCGAAGGTGGTGCCC
NM_004091.3       ATGCTGCAAGGGCCCCGGGCCTTGGCTTCGGCCGCTGGGCAGACCCCGAAGGTGGTGCCC
                  ************************************************************

HsCD00000612      GCGATGAGCCCCACAGAGCTGTGGCCATCCGGCCTCAGCAGCCCCCAGCTCTGCCCAGCT
NM_004091.3       GCGATGAGCCCCACAGAGCTGTGGCCATCCGGCCTCAGCAGCCCCCAGCTCTGCCCAGCT
                  ************************************************************

HsCD00000612      ACTGCTACCTACTACACACCGCTGTACCCGCAGACGGCGCCTCCCGCAGCGGCGCCAGGC
NM_004091.3       ACTGCTACCTACTACACACCGCTGTACCCGCAGACGGCGCCTCCCGCAGCGGCGCCAGGC
                  ************************************************************

HsCD00000612      ACCTGCCTCGACGCCACTCCCCACGGACCCGAGGGCCAAGTTGTGCGATGCCTGCCGGCA
NM_004091.3       ACCTGCCTCGACGCCACTCCCCACGGACCCGAGGGCCAAGTTGTGCGATGCCTGCCGGCA
                  ************************************************************

HsCD00000612      GGCCGGCTGCCGGCCAAAAGGAAGCTGGATCTGGAGGGGATTGGGAGGCCCGTCGTCCCT
NM_004091.3       GGCCGGCTGCCGGCCAAAAGGAAGCTGGATCTGGAGGGGATTGGGAGGCCCGTCGTCCCT
                  ************************************************************

HsCD00000612      GAGTTCCCAACCCCCAAGGGGAAGTGCATCAGAGTGGATGGCCTCCCCAGCCCCAAAACC
NM_004091.3       GAGTTCCCAACCCCCAAGGGGAAGTGCATCAGAGTGGATGGCCTCCCCAGCCCCAAAACC
                  ************************************************************

HsCD00000612      CCCAAATCCCCCGGGGAGAAGACTCGGTATGACACTTCGCTGGGGCTGCTCACCAAGAAG
NM_004091.3       CCCAAATCCCCCGGGGAGAAGACTCGGTATGACACTTCGCTGGGGCTGCTCACCAAGAAG
                  ************************************************************

HsCD00000612      TTCATTTACCTCCTGAGCGAGTCAGAGGATGGGGTCCTGGACCTGAACTGGGCCGCTGAG
NM_004091.3       TTCATTTACCTCCTGAGCGAGTCAGAGGATGGGGTCCTGGACCTGAACTGGGCCGCTGAG
                  ************************************************************

HsCD00000612      GTGCTGGACGTGCAGAAGCGGCGCATCTATGACATCACCAACGTGCTGGAAGGCATCCAG
NM_004091.3       GTGCTGGACGTGCAGAAGCGGCGCATCTATGACATCACCAACGTGCTGGAAGGCATCCAG
                  ************************************************************

HsCD00000612      CTCATCCGCAAGAAGGCCAAGAACAACATCCAGTGGGTAGGCAGGGGAATGTTTGAAGAC
NM_004091.3       CTCATCCGCAAGAAGGCCAAGAACAACATCCAGTGGGTAGGCAGGGGAATGTTTGAAGAC
                  ************************************************************

HsCD00000612      CCCACCAGACCTGGGAAGCAGCAACAGCTGGGGCAGGAGCTGAAGGAGCTGATGAACACG
NM_004091.3       CCCACCAGACCTGGGAAGCAGCAACAGCTGGGGCAGGAGCTGAAGGAGCTGATGAACACG
                  ************************************************************

HsCD00000612      GAGCAGGCCTTGGACCAGCTCATCCAGAGCTGCTCTCTGAGCTTCAAGCACCTGACTGAG
NM_004091.3       GAGCAGGCCTTGGACCAGCTCATCCAGAGCTGCTCTCTGAGCTTCAAGCACCTGACTGAG
                  ************************************************************

HsCD00000612      GACAAGGCCAACAAGAGGCTGGCCTATGTGACTTACCAGGATATCCGTGCTGTTGGCAAC
NM_004091.3       GACAAGGCCAACAAGAGGCTGGCCTATGTGACTTACCAGGATATCCGTGCTGTTGGCAAC
                  ************************************************************

HsCD00000612      TTTAAGGAGCAGACAGTGATTGCCGTCAAGGCCCCTCCGCAGACGAGACTGGAAGTGCCC
NM_004091.3       TTTAAGGAGCAGACAGTGATTGCCGTCAAGGCCCCTCCGCAGACGAGACTGGAAGTGCCC
                  ************************************************************

HsCD00000612      GACAGGACTGAGGACAACCTGCAGATATATCTCAAGAGCACCCAAGGGCCCATCGAAGTC
NM_004091.3       GACAGGACTGAGGACAACCTGCAGATATATCTCAAGAGCACCCAAGGGCCCATCGAAGTC
                  ************************************************************

HsCD00000612      TACCTGTGCCCAGAGGAGGTGCAGGAGCCGGACAGTCCTTCCGAGGAGCCTCTCCCCTCT
NM_004091.3       TACCTGTGCCCAGAGGAGGTGCAGGAGCCGGACAGTCCTTCCGAGGAGCCTCTCCCCTCT
                  ************************************************************

HsCD00000612      ACCTCCACCCTCTGCCCCAGCCCTGACTCTGCCCAGCCCAGCAGCAGCACCGACCCTAGC
NM_004091.3       ACCTCCACCCTCTGCCCCAGCCCTGACTCTGCCCAGCCCAGCAGCAGCACCGACCCTAGC
                  ************************************************************

HsCD00000612      ATCATGGAGCCCACAGCATCCTCAGTGCCAGCACCAGCGCCAACCCCCCAGCAGGCCCCA
NM_004091.3       ATCATGGAGCCCACAGCATCCTCAGTGCCAGCACCAGCGCCAACCCCCCAGCAGGCCCCA
                  ************************************************************

HsCD00000612      CCGCCTCCATCCCTGGTCCCCTTGGAGGCTACTGACAGCCTGCTGGAGCTGCCGCACCCA
NM_004091.3       CCGCCTCCATCCCTGGTCCCCTTGGAGGCTACTGACAGCCTGCTGGAGCTGCCGCACCCA
                  ************************************************************

HsCD00000612      CTCCTGCAGCAGACTGAGGACCAGTTCCTGTCCCCGACCCTGGCGTGCAGCTCCCCTCTG
NM_004091.3       CTCCTGCAGCAGACTGAGGACCAGTTCCTGTCCCCGACCCTGGCGTGCAGCTCCCCTCTG
                  ************************************************************

HsCD00000612      ATCAGCTTCTCCCCATCCTTGGACCAGGACGACTACCTGTGGGGCTTGGAGGCGGGTGAG
NM_004091.3       ATCAGCTTCTCCCCATCCTTGGACCAGGACGACTACCTGTGGGGCTTGGAGGCGGGTGAG
                  ************************************************************

HsCD00000612      GGCATCAGCGATCTCTTCGACTCCTACGACCTTGGGGACCTGTTGATTAATTTG
NM_004091.3       GGCATCAGCGATCTCTTCGACTCCTACGACCTTGGGGACCTGTTGATTAATTGA
                  **************************************************** .

Pathways

NCI : Direct p53 effectors
NCI : E2F transcription factor network
NCI : Regulation of retinoblastoma protein
Reactome : Assembly of the pre-replicative complex
Reactome : Association of licensing factors with the pre-replicative complex
Reactome : CDC6 association with the ORC:origin complex
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular responses to stress
Reactome : Cellular Senescence
Reactome : Cyclin D associated events in G1
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : G1 Phase
Reactome : M/G1 Transition
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Oncogene Induced Senescence
Reactome : Oxidative Stress Induced Senescence
Reactome : Regulation of DNA replication
WikiPathway : Cell cycle
WikiPathway : E2F/MIRHG1 feedback-loop
WikiPathway : G1 to S cell cycle control

Protein

UniProt : Q14209
HPRD : 02692

Clone

Cloning Information : 8588
HIP Master Clone ID : 11083
Original Clone ID : FLH008588.01L

Organism


TAX_ID : 9606
Species Specific ID: 1870

Genome

Chromosome : 1
Map Location : 1p36
Ensembl : ENSG00000007968

Reagents

Labome : E2F2-antibody