DNASU Plasmid Repository • 480.965.5697 | Email

CTSD (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CTSD
Gene Name:  cathepsin D
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH008539.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000616

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1239nts         Open reading frame : 1 to 1239
Reference Sequence Alignment

ATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCTGGCTGCACCCGCCTCCGCG
CTCGTCAGGATCCCGCTGCACAAGTTCACGTCCATCCGCCGGACCATGTCGGAGGTTGGG
GGCTCTGTGGAGGACCTGATTGCCAAAGGCCCCGTCTCAAAGTACTCCCAGGCGGTGCCA
GCCGTGACCGAGGGGCCCATTCCCGAGGTGCTCAAGAACTACATGGACGCCCAGTACTAC
GGGGAGATTGGCATCGGGACGCCCCCCCAGTGCTTCACAGTCGTCTTCGACACGGGCTCC
TCCAACCTGTGGGTCCCCTCCATCCACTGCAAACTGCTGGACATCGCTTGCTGGATCCAC
CACAAGTACAACAGCGACAAGTCCAGCACCTACGTGAAGAATGGTACCTCGTTTGACATC
CACTATGGCTCGGGCAGCCTCTCCGGGTACCTGAGCCAGGACACTGTGTCGGTGCCCTGC
CAGTCAGCGTCGTCAGCCTCTGCCCTGGGCGGTGTCAAAGTGGAGAGGCAGGTCTTTGGG
GAGGCCACCAAGCAGCCAGGCATCACCTTCATCGCAGCCAAGTTCGATGGCATCCTGGGC
ATGGCCTACCCCCGCATCTCCGTCAACAACGTGCTGCCCGTCTTCGACAACCTGATGCAG
CAGAAGCTGGTGGACCAGAACATCTTCTCCTTCTACCTGAGCAGGGACCCAGATGCGCAG
CCTGGGGGTGAGCTGATGCTGGGTGGCACAGACTCCAAGTATTACAAGGGTTCTCTGTCC
TACCTGAATGTCACCCGCAAGGCCTACTGGCAGGTCCACCTGGACCAGGTGGAGGTGGCC
AGCGGGCTGACCCTGTGCAAGGAGGGCTGTGAGGCCATTGTGGACACAGGCACTTCCCTC
ATGGTGGGCCCGGTGGATGAGGTGCGCGAGCTGCAGAAGGCCATCGGGGCCGTGCCGCTG
ATTCAGGGCGAGTACATGATCCCCTGTGAGAAGGTGTCCACCCTGCCCGCGATCACACTG
AAGCTGGGAGGCAAAGGCTACAAGCTGTCCCCAGAGGACTACACGCTCAAGGTGTCGCAG
GCCGGGAAGACCCTCTGCCTGAGCGGCTTCATGGGCATGGACATCCCGCCACCCAGCGGG
CCACTCTGGATCCTGGGCGACGTCTTCATCGGCCGCTACTACACTGTGTTTGACCGTGAC
AACAACAGGGTGGGCTTCGCCGAGGCTGCCCGCCTCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1241
Start on reference sequence 3
Mutations:
None
Discrepancy:
t396g
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CTSD
Symbol Nomenclature : CTSD
SYNONYM : CLN10; CPSD; HEL-S-130P
Designation : ceroid-lipofuscinosis, neuronal 10|epididymis secretory sperm binding protein Li 130P|lysosomal aspartyl peptidase|lysosomal aspartyl protease
Full Nomenclature : cathepsin D
GENEID : 1509
GI : 61356566
GenBank Accession : AY888315
HGNC : 2529
MIM : 116840
Vega : OTTHUMG00000044760
Target GenBank: NM_001909

 

Reference Sequence Alignment

  

HsCD00000616      ATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCTGGCTGCACCCGCCTCCGCG
NM_001909.4       ATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCTGGCTGCACCCGCCTCCGCG
                  ************************************************************

HsCD00000616      CTCGTCAGGATCCCGCTGCACAAGTTCACGTCCATCCGCCGGACCATGTCGGAGGTTGGG
NM_001909.4       CTCGTCAGGATCCCGCTGCACAAGTTCACGTCCATCCGCCGGACCATGTCGGAGGTTGGG
                  ************************************************************

HsCD00000616      GGCTCTGTGGAGGACCTGATTGCCAAAGGCCCCGTCTCAAAGTACTCCCAGGCGGTGCCA
NM_001909.4       GGCTCTGTGGAGGACCTGATTGCCAAAGGCCCCGTCTCAAAGTACTCCCAGGCGGTGCCA
                  ************************************************************

HsCD00000616      GCCGTGACCGAGGGGCCCATTCCCGAGGTGCTCAAGAACTACATGGACGCCCAGTACTAC
NM_001909.4       GCCGTGACCGAGGGGCCCATTCCCGAGGTGCTCAAGAACTACATGGACGCCCAGTACTAC
                  ************************************************************

HsCD00000616      GGGGAGATTGGCATCGGGACGCCCCCCCAGTGCTTCACAGTCGTCTTCGACACGGGCTCC
NM_001909.4       GGGGAGATTGGCATCGGGACGCCCCCCCAGTGCTTCACAGTCGTCTTCGACACGGGCTCC
                  ************************************************************

HsCD00000616      TCCAACCTGTGGGTCCCCTCCATCCACTGCAAACTGCTGGACATCGCTTGCTGGATCCAC
NM_001909.4       TCCAACCTGTGGGTCCCCTCCATCCACTGCAAACTGCTGGACATCGCTTGCTGGATCCAC
                  ************************************************************

HsCD00000616      CACAAGTACAACAGCGACAAGTCCAGCACCTACGTGAAGAATGGTACCTCGTTTGACATC
NM_001909.4       CACAAGTACAACAGCGACAAGTCCAGCACCTACGTGAAGAATGGTACCTCGTTTGACATC
                  ************************************************************

HsCD00000616      CACTATGGCTCGGGCAGCCTCTCCGGGTACCTGAGCCAGGACACTGTGTCGGTGCCCTGC
NM_001909.4       CACTATGGCTCGGGCAGCCTCTCCGGGTACCTGAGCCAGGACACTGTGTCGGTGCCCTGC
                  ************************************************************

HsCD00000616      CAGTCAGCGTCGTCAGCCTCTGCCCTGGGCGGTGTCAAAGTGGAGAGGCAGGTCTTTGGG
NM_001909.4       CAGTCAGCGTCGTCAGCCTCTGCCCTGGGCGGTGTCAAAGTGGAGAGGCAGGTCTTTGGG
                  ************************************************************

HsCD00000616      GAGGCCACCAAGCAGCCAGGCATCACCTTCATCGCAGCCAAGTTCGATGGCATCCTGGGC
NM_001909.4       GAGGCCACCAAGCAGCCAGGCATCACCTTCATCGCAGCCAAGTTCGATGGCATCCTGGGC
                  ************************************************************

HsCD00000616      ATGGCCTACCCCCGCATCTCCGTCAACAACGTGCTGCCCGTCTTCGACAACCTGATGCAG
NM_001909.4       ATGGCCTACCCCCGCATCTCCGTCAACAACGTGCTGCCCGTCTTCGACAACCTGATGCAG
                  ************************************************************

HsCD00000616      CAGAAGCTGGTGGACCAGAACATCTTCTCCTTCTACCTGAGCAGGGACCCAGATGCGCAG
NM_001909.4       CAGAAGCTGGTGGACCAGAACATCTTCTCCTTCTACCTGAGCAGGGACCCAGATGCGCAG
                  ************************************************************

HsCD00000616      CCTGGGGGTGAGCTGATGCTGGGTGGCACAGACTCCAAGTATTACAAGGGTTCTCTGTCC
NM_001909.4       CCTGGGGGTGAGCTGATGCTGGGTGGCACAGACTCCAAGTATTACAAGGGTTCTCTGTCC
                  ************************************************************

HsCD00000616      TACCTGAATGTCACCCGCAAGGCCTACTGGCAGGTCCACCTGGACCAGGTGGAGGTGGCC
NM_001909.4       TACCTGAATGTCACCCGCAAGGCCTACTGGCAGGTCCACCTGGACCAGGTGGAGGTGGCC
                  ************************************************************

HsCD00000616      AGCGGGCTGACCCTGTGCAAGGAGGGCTGTGAGGCCATTGTGGACACAGGCACTTCCCTC
NM_001909.4       AGCGGGCTGACCCTGTGCAAGGAGGGCTGTGAGGCCATTGTGGACACAGGCACTTCCCTC
                  ************************************************************

HsCD00000616      ATGGTGGGCCCGGTGGATGAGGTGCGCGAGCTGCAGAAGGCCATCGGGGCCGTGCCGCTG
NM_001909.4       ATGGTGGGCCCGGTGGATGAGGTGCGCGAGCTGCAGAAGGCCATCGGGGCCGTGCCGCTG
                  ************************************************************

HsCD00000616      ATTCAGGGCGAGTACATGATCCCCTGTGAGAAGGTGTCCACCCTGCCCGCGATCACACTG
NM_001909.4       ATTCAGGGCGAGTACATGATCCCCTGTGAGAAGGTGTCCACCCTGCCCGCGATCACACTG
                  ************************************************************

HsCD00000616      AAGCTGGGAGGCAAAGGCTACAAGCTGTCCCCAGAGGACTACACGCTCAAGGTGTCGCAG
NM_001909.4       AAGCTGGGAGGCAAAGGCTACAAGCTGTCCCCAGAGGACTACACGCTCAAGGTGTCGCAG
                  ************************************************************

HsCD00000616      GCCGGGAAGACCCTCTGCCTGAGCGGCTTCATGGGCATGGACATCCCGCCACCCAGCGGG
NM_001909.4       GCCGGGAAGACCCTCTGCCTGAGCGGCTTCATGGGCATGGACATCCCGCCACCCAGCGGG
                  ************************************************************

HsCD00000616      CCACTCTGGATCCTGGGCGACGTCTTCATCGGCCGCTACTACACTGTGTTTGACCGTGAC
NM_001909.4       CCACTCTGGATCCTGGGCGACGTCTTCATCGGCCGCTACTACACTGTGTTTGACCGTGAC
                  ************************************************************

HsCD00000616      AACAACAGGGTGGGCTTCGCCGAGGCTGCCCGCCTCTAG
NM_001909.4       AACAACAGGGTGGGCTTCGCCGAGGCTGCCCGCCTCTAG
                  ***************************************

Pathways

NCI : Ceramide signaling pathway
NCI : Direct p53 effectors
NCI : LKB1 signaling events
NCI : Validated nuclear estrogen receptor alpha network
Reactome : Adaptive Immune System
Reactome : Collagen degradation
Reactome : Degradation of the extracellular matrix
Reactome : Extracellular matrix organization
Reactome : Immune System
Reactome : MHC class II antigen presentation
Reactome : Metabolism of Angiotensinogen to Angiotensins
Reactome : Metabolism of proteins
Reactome : Peptide hormone metabolism
WikiPathway : Prolactin Signaling Pathway

Protein

UniProt : P07339
HPRD : 00291

Clone

Cloning Information : 8539
HIP Master Clone ID : 11034
Original Clone ID : FLH008539.01X

Organism


TAX_ID : 9606
Species Specific ID: 1509

Genome

Chromosome : 11
Map Location : 11p15.5
Ensembl : ENSG00000117984

Reagents

Labome : cathepsin-D-antibody