DNASU Plasmid Repository • 480.965.5697 | Email

PIK3CD (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3CD
Gene Name:  phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
Sequence             
Original Clone ID: FLH232215.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00617912

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3135nts         Open reading frame : 196 to 3330

CAGTCGCTCCGAGCGGCCGCGAGCAGAGCCGCCCAGCCCTGTCAGCTGCGCCGGGACGAT
AAGGAGTCAGGCCAGGGCGGGATGACACTCATTGATTCTAAAGCATCTTTAATCTGCCAG
GCGGAGGGGGCTTTGCTGGTCTTTCTTGGACTATTCCAGAGAGGACAACTGTCATCTGGG
AAGTAACAACGCAGGATGCCCCCTGGGGTGGACTGCCCCATGGAATTCTGGACCAAGGAG
GAGAATCAGAGCGTTGTGGTTGACTTCCTGCTGCCCACAGGGGTCTACCTGAACTTCCCT
GTGTCCCGCAATGCCAACCTCAGCACCATCAAGCAGCTGCTGTGGCACCGCGCCCAGTAT
GAGCCGCTCTTCCACATGCTCAGTGGCCCCGAGGCCTATGTGTTCACCTGCATCAACCAG
ACAGCGGAGCAGCAAGAGCTGGAGGACGAGCAACGGCGTCTGTGTGACGTGCAGCCCTTC
CTGCCCGTCCTGCGCCTGGTGGCCCGTGAGGGCGACCGCGTGAAGAAGCTCATCAACTCA
CAGATCAGCCTCCTCATCGGCAAAGGCCTCCACGAGTTTGACTCCTTGTGCGACCCAGAA
GTGAACGACTTTCGCGCCAAGATGTGCCAATTCTGCGAGGAGGCGGCCGCCCGCCGGCAG
CAGCTGGGCTGGGAGGCCTGGCTGCAGTACAGTTTCCCCCTGCAGCTGGAGCCCTCGGCT
CAAACCTGGGGGCCTGGTACCCTGCGGCTCCCGAACCGGGCCCTTCTGGTCAACGTTAAG
TTTGAGGGCAGCGAGGAGAGCTTCACCTTCCAGGTGTCCACCAAGGACGTGCCGCTGGCG
CTGATGGCCTGTGCCCTGCGGAAGAAGGCCACAGTGTTCCGGCAGCCGCTGGTGGAGCAG
CCGGAAGACTACACGCTGCAGGTGAACGGCAGGCATGAGTACCTGTATGGCAACTACCCG
CTCTGCCAGTTCCAGTACATCTGCAGCTGCCTGCACAGTGGGTTGACCCCTCACCTGACC
ATGGTCCATTCCTCCTCCATCCTCGCCATGCGGGATGAGCAGAGCAACCCTGCCCCCCAG
GTCCAGAAACCGCGTGCCAAACCACCTCCCATTCCTGCGAAGAAGCCTTCCTCTGTGTCC
CTGTGGTCCCTGGAGCAGCCGTTCCGCATCGAGCTCATCCAGGGCAGCAAAGTGAACGCC
GACGAGCGGATGAAGCTGGTGGTGCAGGCCGGGCTTTTCCACGGCAACGAGATGCTGTGC
AAGACGGTGTCCAGCTCGGAGGTGAGCGTGTGCTCGGAGCCCGTGTGGAAGCAGCGGCTG
GAGTTCGACATCAACATCTGCGACCTGCCCCGCATGGCCCGTCTCTGCTTTGCGCTGTAC
GCCGTGATCGAGAAAGCCAAGAAGGCTCGCTCCACCAAGAAGAAGTCCAAGAAGGCGGAC
TGCCCCATTGCCTGGGCCAACCTCATGCTGTTTGACTACAAGGACCAGCTTAAGACCGGG
GAACGCTGCCTCTACATGTGGCCCTCCGTCCCAGATGAGAAGGGCGAGCTGCTGAACCCC
ACGGGCACTGTGCGCAGTAACCCCAACACGGATAGCGCCGCTGCCCTGCTCATCTGCCTG
CCCGAGGTGGCCCCGCACCCCGTGTACTACCCCGCCCTGGAGAAGATCTTGGAGCTGGGG
CGACACAGCGAGTGTGTGCATGTCACCGAGGAGGAGCAGCTGCAGCTGCGGGAAATCCTG
GAGCGGCGGGGGTCTGGGGAGCTGTATGAGCACGAGAAGGACCTGGTGTGGAAGCTGCGG
CATGAAGTCCAGGAGCACTTCCCGGAGGCGCTAGCCCGGCTGCTGCTGGTCACCAAGTGG
AACAAGCATGAGGATGTGGCCCAGATGCTCTACCTGCTGTGCTCCTGGCCGGAGCTGCCC
GTCCTGAGCGCCCTGGAGCTGCTAGACTTCAGCTTCCCCGATTGCCACGTAGGCTCCTTC
GCCATCAAGTCGCTGCGGAAACTGACGGACGATGAGCTGTTCCAGTACCTGCTGCAGCTG
GTGCAGGTGCTCAAGTACGAGTCCTACCTGGACTGCGAGCTGACCAAATTCCTGCTGGAC
CGGGCCCTGGCCAACCGCAAGATCGGCCACTTCCTTTTCTGGCACCTCCGCTCCGAGATG
CACGTGCCGTCGGTGGCCCTGCGCTTCGGCCTCATCCTGGAGGCCTACTGCAGGGGCAGC
ACCCACCACATGAAGGTGCTGATGAAGCAGGGGGAAGCACTGAGCAAACTGAAGGCCCTG
AATGACTTCGTCAAGCTGAGCTCTCAGAAGACCCCCAAGCCCCAGACCAAGGAGCTGATG
CACTTGTGCATGCGGCAGGAGGCCTACCTAGAGGCCCTCTCCCACCTGCAGTCCCCACTC
GACCCCAGCACCCTGCTGGCTGAAGTCTGCGTGGAGCAGTGCACCTTCATGGACTCCAAG
ATGAAGCCCCTGTGGATCATGTACAGCAACGAGGAGGCAGGCAGCGGCGGCAGCGTGGGC
ATCATCTTTAAGAACGGGGATGACCTCCGGCAGGACATGCTGACCCTGCAGATGATCCAG
CTCATGGACGTCCTGTGGAAGCAGGAGGGGCTGGACCTGAGGATGACCCCCTATGGCTGC
CTCCCCACCGGGGACCGCACAGGCCTCATTGAGGTGGTACTCCGTTCAGACACCATCGCC
AACATCCAACTCAACAAGAGCAACATGGCAGCCACAGCCGCCTTCAACAAGGATGCCCTG
CTCAACTGGCTGAAGTCCAAGAACCCGGGGGAGGCCCTGGATCGAGCCATTGAGGAGTTC
ACCCTCTCCTGTGCTGGCTATTGTGTGGCCACATATGTGCTGGGCATTGGCGATCGGCAC
AGCGACAACATCATGATCCGAGAGAGTGGGCAGCTGTTCCACATTGATTTTGGCCACTTT
CTGGGGAATTTCAAGACCAAGTTTGGAATCAACCGCGAGCGTGTCCCATTCATCCTCACC
TATGACTTTGTCCATGTGATTCAGCAGGGGAAGACTAATAATAGTGAGAAATTTGAACGG
TTCCGGGGCTACTGTGAAAGGGCCTACACCATCCTGCGGCGCCACGGGCTTCTCTTCCTC
CACCTCTTTGCCCTGATGCGGGCGGCAGGCCTGCCTGAGCTCAGCTGCTCCAAAGACATC
CAGTATCTCAAGGACTCCCTGGCACTGGGGAAAACAGAGGAGGAGGCACTGAAGCACTTC
CGAGTGAAGTTTAACGAAGCCCTCCGTGAGAGCTGGAAAACCAAAGTGAACTGGCTGGCC
CACAACGTGTCCAAAGACAACAGGCAGTAGTGGCTCCTCCCAGCCCTGGGCCCAAGAGGA
GGCGGCTGCGGGTCGTGGGGACCAAGCACATTGGTCCTAAAGGGGCTGAAGAGCCTGAAC
TGCACCTAACGGGAAAGAACCGACATGGCTGCCTTTTGTTTACACTGGTTATTTATTTAT
GACTTGAAATAGTTTAAGGAGCTAAACAGCCATAAACGGAAACGCCTCCTTCATTCAGCG
GCGGTGCTGGGCCCCCCGAGGCTGCACCTGGCTCTCGGCTGAGGATTGTCACCCCAAGTC
TTCCAGCTGGTGGATCTGGGCCCAGCAAAGACTGTTCTCCTCCCGAGGGAACCTTCTTCC
CAGGCCTCCCGCCAGACTGCCTGGGTCCTGGCGCCTGGCGGTCACCTGGTGCCTACTGTC
CGACAGGATGCCTCGATCCTCGTGCGACCCACCCTGTGTATCCTCCCTAGACTGAGTTCT
GGCAGCTCCCCGAGGCAGCCGGGGTACCCTCTAGATTCAGGGATGCTTGCTCTCCACTTT
TCAAGTGGGTCTTGGGTACGAGAATTCCCTCATCTTTCTCTACTGTAAAGTGATTTTGTT
TGCAGGTAAGAAAATAATAGATGACTCACCACACCTCTACGGCTGGGGAGATCAGGCCCA
GCCCCATAAAGGAGAATCTACGCTGGTCCTCAGGACGTGTTAAAGAGATCTGGGCCTCAT
GTAGCTCACCCCGGTCACGCATGAAGGCAAAAGCAGGTCAGAAGCGAATACTCTGCCATT
ATCTCAAAAATCTTTTTTTTTTTTTTTTTGAGATGGGGTCTTCCTCTGTTGCCCAGGCTG
GAGTGCAGTGGTGCAATCTTGGCTCACTGTAACCTCCGCCTCCCAGGTTCAAGTGATTCT
TCTTGCCTCAGCCTCCTGAGTAGCTGGGATTACAGGTGTGCACCACCCGTACCCAGCTAA
TTTTTGTATTTTAGTAGAGACGGGGGTTTCACCATGTTGGCTGGGCTGGTCTCGAACTCC
TGACCTCAGGTGATCCACCCGCCTGAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCC
ACCACGCCCGGCCCACTCTGCCATTGTCTAAGCCACCTCTGAAAGCAGGTTTTAACAAAA
GGATGAGGCCAGAACTCTTCCAGAACCATCACCTTTGGGAACCTGCTGTGAGAGTGCTGA
GGTACCAGAAGTGTGAGAACGAGGGGGCGTGCTGGGATCTTTCTCTCTGACTATACTTAG
TTTGAAATGGTGCAGGCTTAGTCTTAAGCCTCCAAAGGCCTGGATTTGAGCAGCTTTAGA
AATGCAGGTTCTAGGGCTTCTCCCAGCCTTCAGAAGCCAACTAACTCTGCAGATGGGGCT
AGGACTGTGGGCTTTTAGCAGCCCACAGGTGATCCTAACATATCAGGCCATGGACTCAGG
ACCTGCCCGGTGATGCTGTTGATTTCTCAAAGGTCTTCCAAAACTCAACAGAGCCAGAAG
TAGCCGCCCGCTCAGCGGCTCAGGTGCCAGCTCTGTTCTGATTCACCAGGGGTCCGTCAG
TAGTCATTGCCACCCGCGGGGCACCTCCCTGGCCACACGCCTGTTCCCAGCAAGTGCTGA
AACTCACTAGACCGTCTGCCTGTTTCGAAATGGGGAAAGCCGTGCGTGCGCGTTATTTAT
TTAAGTGCGCCTGTGTGCGCGGGTGTGGGAGCACACTTTGCAAAGCCACAGCGTTTCTGG
TTTTGGGTGTACAGTCTTGTGTGCCTGGCGAGAAGAATATTTTCTATTTTTTTAAGTCAT
TTCATGTTTCTGTCTGGGGAAGGCAAGTTAGTTAAGTATCACTGATGTGGGTTGAGACCA
GCACTCTGTGAAACCTTGAAATGAGAAGTAAAGGCAGATGAAAAGAAAAAAAAAAAAAAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3CD
Symbol Nomenclature : PIK3CD
SYNONYM : APDS; IMD14; P110DELTA; PI3K; p110D
Designation : PI3-kinase p110 subunit delta|PI3Kdelta|phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform|phosphatidylinositol-4,5-bisphosphate 3-kinase 110 kDa catalytic subunit delta|phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta isoform|phosphoinositide-3-kinase C|phosphoinositide-3-kinase, catalytic, delta polypeptide variant p37delta|ptdIns-3-kinase subunit p110-delta
Full Nomenclature : phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
GENEID : 5293
Locus Tag : RP11-558F24.3
HGNC : 8977
MIM : 602839
Vega : OTTHUMG00000001450
Target GenBank: NM_005026

 

Pathways

NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : EGF receptor (ErbB1) signaling pathway
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : ErbB4 signaling events
NCI : FAS (CD95) signaling pathway
NCI : Internalization of ErbB1
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : PDGFR-beta signaling pathway
NCI : Signaling events mediated by TCPTP
NCI : TRAIL signaling pathway
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : Axon guidance mediated by netrin
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Adaptive Immune System
Reactome : Antigen activates B Cell Receptor (BCR) leading to generation of second messengers
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PI Metabolism
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipid metabolism
Reactome : Regulation of signaling by CBL
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Synthesis of PIPs at the plasma membrane
WikiPathway : AMPK signaling
WikiPathway : Focal Adhesion
WikiPathway : G13 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : angiogenesis overview

Clone

Cloning Information : 654646
HIP Master Clone ID : 148537
Original Clone ID : HsCD00301044
Original Clone ID : FLH231627.01L
Original Clone ID : HsCD00299217
Original Clone ID : FLH232215.01L

Organism


TAX_ID : 9606
Species Specific ID: 5293

Genome

Chromosome : 1
Map Location : 1p36.2
Ensembl : ENSG00000171608

Reagents

Labome : PIK3CD-antibody