DNASU Plasmid Repository • 480.965.5697 | Email

TBK1 (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TBK1
Gene Name:  TANK-binding kinase 1
Sequence             
Original Clone ID: HsCD00298868
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00617913

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2190nts         Open reading frame : 105 to 2294

AGCGGGGAAGTGTCCTGAGTCTCGAGGAGGCCGCGGGAGCCCGCCGGCGGTGGCGCGGCG
GAGACCCGGCTGGTATAACAAGAGGATTGCCTGATCCAGCCAAGATGCAGAGCACTTCTA
ATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACTGCAAATGTCTTTCGTG
GAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTTAATAACATAAGCTTCC
TTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAAAAACTCAATCACAAAA
ATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGACATAAAGTACTTATTA
TGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAACCTTCTAATGCCTATG
GACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTGGGTGGAATGAATCATC
TACGAGAGAATGGTATAGTGCACCGTGATATCAAGCCAGGAAATATCATGCGTGTTATAG
GGGAAGATGGACAGTCTGTGTACAAACTCACAGATTTTGGTGCAGCTAGAGAATTAGAAG
ATGATGAGCAGTTTGTTTCTCTGTATGGCACAGAAGAATATTTGCACCCTGATATGTATG
AGAGAGCAGTGCTAAGAAAAGATCATCAGAAGAAATATGGAGCAACAGTTGATCTTTGGA
GCATTGGGGTAACATTTTACCATGCAGCTACTGGATCACTGCCATTTAGACCCTTTGAAG
GGCCTCGTAGGAATAAAGAAGTGATGTATAAAATAATTACAGGAAAGCCTTCTGGTGCAA
TATCTGGAGTACAGAAAGCAGAAAATGGACCAATTGACTGGAGTGGAGACATGCCTGTTT
CTTGCAGTCTTTCTCGGGGTCTTCAGGTTCTACTTACCCCTGTTCTTGCAAACATCCTTG
AAGCAGATCAGGAAAAGTGTTGGGGTTTTGACCAGTTTTTTGCAGAAACTAGTGATATAC
TTCACCGAATGGTAATTCATGTTTTTTCGCTACAACAAATGACAGCTCATAAGATTTATA
TACATAGCTATAATACTGCTACTATATTTCATGAACTGGTATATAAACAAACCAAAATTA
TTTCTTCAAATCAAGAACTTATCTACGAAGGGCGACGCTTAGTCTTAGAACCTGGAAGGC
TGGCACAACATTTCCCTAAAACTACTGAGGAAAACCCTATATTTGTAGTAAGCCGGGAAC
CTCTGGATACCATAGGATTAATATATGAAAAAATTTCCCTCCCTAAAGTACATCCACGTT
ATGATTTAGACGGGGATGCTAGCATGGCTAAGGCAATAACAGGGGTTGTGTGTTATGCCT
GCAGAATTGCCAGTACCTTACTGCTTTATCAGGAATTAATGCGAAAGGGGATACGATGGC
TGATTGAATTAATTAAAGATGATTACAATGAAACTGTTCACAAAAAGACAGAAGTTGTGA
TCACATTGGATTTCTGTATCAGAAACATTGAAAAAACTGTGAAAGTATATGAAAAGTTGA
TGAAGATCAACCTGGAAGCGGCAGAGTTAGGTGAAATTTCAGACATACACACCAAATTGT
TGAGACTTTCCAGTTCTCAGGGAACAATAGAAACCAGTCTTCAGGATATCGACAGCAGAT
TATCTCCAGGTGGATCACTGGCAGACGCATGGGCACATCAAGAAGGCACTCATCCGAAAG
ACAGAAATGTAGAAAAACTACAAGTCCTGTTAAATTGCATGACAGAGATTTACTATCAGT
TCAAAAAAGACCAAGCAGAACGTAGATTAGCTTATAATGAAGAACAAATCCACAAATTTG
ATAAGCAAAAACTGTATTACCATGCCACAAAAGCTATGACGCACTTTACAGATGAATGTG
TTAAAAAGTATGAGGCATTTTTGAATAAGTCAGAAGAATGGATAAGAAAGATGCTTCATC
TTAGGAAACAGTTATTATCGCTGACTAATCAGTGTTTTGATATTGAAGAAGAAGTATCAA
AATATCAAGAATATACTAATGAGTTACAAGAAACTCTGCCTCAGAAAATGTTTACAGCTT
CCAGTGGAATCAAACATACCATGACCCCAATTTATCCAAGTTCTAACACATTAGTAGAAA
TGACTCTTGGTATGAAGAAATTAAAGGAAGAGATGGAAGGGGTGGTTAAAGAACTTGCTG
AAAATAACCACATTTTAGAAAGGTTTGGCTCTTTAACCATGGATGGTGGCCTTCGCAACG
TTGACTGTCTTTAGCTTTCTAATAGAAGTTTAAGAAAAGTTTCCGTTTGCACAAGAAAAT
AACGCTTGGGCATTAAATGAATGCCTTTATAGATAGTCACTTGTTTCTACAATTCAGTAT
TTGATGTGGTCGTGTAAATATGTACAATATTGTAAATACATAAAAAATATACAAATTTTT
GGCTGCTGTGAAGATGTAATTTTATCTTTTAACATTTATAATTATATGAGGAAATTTGAC
CTCAGTGATCACGAGAAGAAAGCCATGACCGACCAATATGTTGACATACTGATCCTCTAC
TCTGAGTGGGGCTAAATAAGTTATTTTCTCTGACCGCCTACTGGAAATATTTTTAAGTGG
AACCAAAATAGGCATCCTTACAAATCAGGAAGACTGACTTGACACGTTTGTAAATGGTAG
AACGGTGGCTACTGTGAGTGGGGAGCAGAACCGCACCACTGTTATACTGGGATAACAATT
TTTTTGAGAAGGATAAAGTGGCATTATTTTATTTTACAAGGTGCCCAGATCCCAGTTATC
CTTGTATCCATGTAATTTCAGATGAATTATTAAGCAAACATTTTAAAGTGAATTCATTAT
TAAAAACTATTCATTTTTTTCCTTTGGCCATAAATGTGTAATTGTCATTAAAATTCTAAG
GTCATTTCAACTGTTTTAAGCTGTATTTCTTTAATTCTGCTTACTATTTCATGGAAAAAA
ATAAATTTCTCAATTTTAAAAAAAAAAAAGAAAAAAAAAAAAAAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TBK1
Symbol Nomenclature : TBK1
SYNONYM : NAK; T2K
Designation : NF-kB-activating kinase|NF-kappa-B-activating kinase|serine/threonine-protein kinase TBK1
Full Nomenclature : TANK-binding kinase 1
GENEID : 29110
HGNC : 11584
MIM : 604834
Vega : OTTHUMG00000168796
Target GenBank: BC034950

 

Pathways

Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Activation of IRF3/IRF7 mediated by TBK1/IKK epsilon
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : IRF3 mediated activation of type 1 IFN
Reactome : IRF3-mediated induction of type I IFN
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MyD88-independent cascade
Reactome : Negative regulators of RIG-I/MDA5 signaling
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulation of innate immune responses to cytosolic DNA
Reactome : STAT6-mediated induction of chemokines
Reactome : STING mediated induction of host immune responses
Reactome : TRAF3-dependent IRF activation pathway
Reactome : TRAF6 mediated IRF7 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : ZBP1(DAI) mediated induction of type I IFNs
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 654647
HIP Master Clone ID : 134856
Original Clone ID : FLH230195.01L
Original Clone ID : HsCD00299386
Original Clone ID : FLH231628.01L
Original Clone ID : HsCD00298868

Organism


TAX_ID : 9606
Species Specific ID: 29110

Genome

Chromosome : 12
Map Location : 12q14.1
Ensembl : ENSG00000183735

Reagents

Labome : TBK1-antibody