DNASU Plasmid Repository • 480.965.5697 | Email

AURKB (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AURKB
Gene Name:  aurora kinase B
Sequence             
Original Clone ID: HsCD00298713
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00617934

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1035nts         Open reading frame : 58 to 1092

GGCCGGGAGAGTAGCAGTGCCTTGGACCCCAGCTCTCCTCCCCCTTTCTCTCTAAGGATG
GCCCAGAAGGAGAACTCCTACCCCTGGCCCTACGGCCGACAGACGGCTCCATCTGGCCTG
AGCACCCTGCCCCAGCGAGTCCTCCGGAAAGAGCCTGTCACCCCATCTGCACTTGTCCTC
ATGAGCCGCTCCAATGTCCAGCCCACAGCTGCCCCTGGCCAGAAGGTGATGGAGAATAGC
AGTGGGACACCCGACATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGT
CCTCTGGGCAAAGGCAAGTTTGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTC
ATCGTGGCGCTCAAGGTCCTCTTCAAGTCCCAGATAGAGAAGGAGGGCGTGGAGCATCAG
CTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATCCCAACATCCTGCGTCTCTAC
AACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCCCCGCGGGGAG
CTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGAACAGCCACGATCATG
GAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGAAGGTGATTCACAGAGACATA
AAGCCAGAAAATCTGCTCTTAGGGCTCAAGGGAGAGCTGAAGATTGCTGACTTCGGCTGG
TCTGTGCATGCGCCCTCCCTGAGGAGGAAGACAATGTGTGGCACCCTGGACTACCTGCCC
CCAGAGATGATTGAGGGGCGCATGCACAATGAGAAGGTGGATCTGTGGTGCATTGGAGTG
CTTTGCTATGAGCTGCTGGTGGGGAACCCACCCTTTGAGAGTGCATCACACAACGAGACC
TATCGCCGCATCGTCAAGGTGGACCTAAAGTTCCCCGCTTCTGTGCCCACGGGAGCCCAG
GACCTCATCTCCAAACTGCTCAGGCATAACCCCTCGGAACGGCTGCCCCTGGCCCAGGTC
TCAGCCCACCCTTGGGTCCGGGCCAACTCTCGGAGGGTGCTGCCTCCCTCTGCCCTTCAA
TCTGTCGCCTGATGGTCCCTGTCATTCACTCGGGTGCGTGTGTTTGTATGTCTGTGTATG
TATAGGGGAAAGAAGGGATCCCTAACTGTTCCCTTATCTGTTTTCTACCTCCTCCTTTGT
TTAATAAAGGCTGAAGCTTTTTGT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : AURKB
Symbol Nomenclature : AURKB
SYNONYM : AIK2; AIM-1; AIM1; ARK2; AurB; IPL1; PPP1R48; STK12; STK5; aurkb-sv1; aurkb-sv2
Designation : ARK-2|STK-1|aurora 1|aurora kinase B-Sv1|aurora kinase B-Sv2|aurora- and Ipl1-like midbody-associated protein 1|aurora-1|aurora-B|aurora-related kinase 2|aurora/IPL1-related kinase 2|protein phosphatase 1, regulatory subunit 48|serine/threonine kinase 12|serine/threonine-protein kinase 12|serine/threonine-protein kinase 5|serine/threonine-protein kinase aurora-B
Full Nomenclature : aurora kinase B
GENEID : 9212
HGNC : 11390
MIM : 604970
Vega : OTTHUMG00000108189
Target GenBank: NM_004217

 

Pathways

NCI : Aurora A signaling
NCI : Aurora B signaling
NCI : Aurora C signaling
NCI : FOXM1 transcription factor network
NCI : Signaling by Aurora kinases
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : M Phase
Reactome : Mitotic Anaphase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Prometaphase
Reactome : Regulation of mitotic cell cycle
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : Separation of Sister Chromatids
WikiPathway : Epithelium TarBase
WikiPathway : Lymphocyte TarBase

Clone

Cloning Information : 654694
HIP Master Clone ID : 14576
Original Clone ID : FLH230860.01X
Original Clone ID : HsCD00299426
Original Clone ID : FLH231675.01L
Original Clone ID : HsCD00298713

Organism


TAX_ID : 9606
Species Specific ID: 9212

Genome

Chromosome : 17
Map Location : 17p13.1
Ensembl : ENSG00000178999

Reagents

Labome : AIM-1-antibody