DNASU Plasmid Repository • 480.965.5697 | Email

ATM (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PKP2
Gene Name:  plakophilin 2
Sequence             
Original Clone ID: FLH232151.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00617944

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 417nts         Open reading frame : 74 to 490
Reference Sequence Alignment

TGAAAACTTATTGGGAAAACAGATTGATCACTTATTCATTAGTAATTTACCAGAGATTGT
GGTGGAGTTATTGATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAGAGCACTGA
CCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCATTTTCCATCGCA
TGTGGTTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAGTTAAAAAGCAT
TTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTTGCCATATGTGA
GCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAAATATATCACCT
GTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCTTGGGCCTTTGT
TCTTCGAGACGTTATTTATACTTTGATTCACTATATCAACCAAAGGAAATTAACCATTTT
CTCTCAGTAAGTGTTTATGATGCACTTCCATTGACAAGACTTGAAGGACTAAAGGATCTT
CGAAGACAACTGGAACTACATAAAGATCAGATGGTGGACATTATGAGAGCTTCTCAGGGT
GCTAATTTTAAATGACATGGGCTATTTCTACCTGTTTCTTTTTGAAAGAATATTTTGCAA
AGTCTTGCTCTTGGTTTCATTGTCACAGACTTAGTTCAGACTCTCATCATTTAGTTCAGA
CCCTCATTTCTCATCTAACTGTAAAACTGGTCCTAACTGGTCTTCTCACCCTGAACTCTT
CCTGTTTTATTCATCCTCTGCCAGATGATTTCTCTAAACCCAAATATGATCATGTTTTTC
TACTGCCTAAATTTTTTTTTTAAGAGACAGAGTTTTTTTTTTTTTTTAAGAGTCTCACTC
TGTCACCTAGGCTGGAGTGTAGTGGCACCATCATAACTTACTATGACCTTGAATTCCTGG
GTACAAGGAATTCTCCTGTCTCAGCCTTCTGAATAGCTGGAACAACAGGCACACACCACT
ACACCTAGCTACTTTATTTATTTTTTTTATTTTTTGTAGGGACAGGGGTCCCACTATGTT
GCCTAGGTTGGTCTCGAATTCTTGGCCTCAAGTGATCCTCCTGCCTTAGCCTCACAAAGC
ATTGGGATTAGAGGTGTGAGCCACGGCATCTAGCCATGCTTAAACATTTTTCATTTCTTT
TTCTTTTTTTTTAAGACGGAGTTTCGCTCTTGTTGCCCAGGCTGGAATGCAGTGGCACTA
TCTTAGCTCACTGCAACCTCCACCTCCTGAGCTCAGATTCTCGTGCCTCAGCCTTCCTAG
TAGCTAGGATTACAGGCACCTGCCACCATGCCTGGCTAATTTTTTGTATTTTTTTTAGTA
GAGACGGGGTTTCACCATGTTGGCCAGGGTGGTCTCAAACTCCTGAGCTCAGGCAATCCG
CCCACCTCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCGCGGCTGGCCCATG
CTTAAACATTTTTAACACCTTCCAACCATGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
A


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PKP2
Symbol Nomenclature : PKP2
SYNONYM : ARVD9
Designation : plakophilin-2
Full Nomenclature : plakophilin 2
GENEID : 5318
HGNC : 9024
MIM : 602861
Vega : OTTHUMG00000169500
Target GenBank: BC007023

 

Reference Sequence Alignment

  

HsCD00617944      ------------------------------------------------------------
NM_004572.3       ATGGCAGCCCCCGGCGCCCCAGCTGAGTACGGCTACATCCGGACCGTCCTGGGCCAGCAG
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       ATCCTGGGACAACTGGACAGCTCCAGCCTGGCGCTGCCCTCCGAGGCCAAGCTGAAGCTG
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       GCGGGGAGCAGCGGCCGCGGCGGCCAGACAGTCAAGAGCCTGCGGATCCAGGAGCAGGTG
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       CAGCAGACCCTCGCCCGGAAGGGCCGCAGCTCCGTGGGCAACGGAAATCTTCACCGAACC
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       AGCAGTGTTCCTGAGTATGTCTACAACCTACACTTGGTTGAAAATGATTTTGTTGGAGGC
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       CGTTCCCCTGTTCCTAAAACCTATGACATGCTAAAGGCTGGCACAACTGCCACTTATGAA
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       GGTCGCTGGGGAAGAGGAACAGCACAGTACAGCTCCCAGAAGTCCGTGGAAGAAAGGTCC
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       TTGAGGCATCCTCTGAGGAGACTGGAGATTTCTCCTGACAGCAGCCCGGAGAGGGCTCAC
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       TACACGCACAGCGATTACCAGTACAGCCAGAGAAGCCAGGCTGGGCACACCCTGCACCAC
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       CAAGAAAGCAGGCGGGCCGCCCTCCTAGTGCCACCGAGATATGCTCGTTCCGAGATCGTG
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       GGGGTCAGCCGTGCTGGCACCACAAGCAGGCAGCGCCACTTTGACACATACCACAGACAG
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       TACCAGCATGGCTCTGTTAGCGACACCGTTTTTGACAGCATCCCTGCCAACCCGGCCCTG
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       CTCACGTACCCCAGGCCAGGGACCAGCCGCAGCATGGGCAACCTCTTGGAGAAGGAGAAC
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       TACCTGACGGCAGGGCTCACTGTCGGGCAGGTCAGGCCGCTGGTGCCCCTGCAGCCCGTC
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       ACTCAGAACAGGGCTTCCAGGTCCTCCTGGCATCAGAGCTCCTTCCACAGCACCCGCACG
                                                                              

HsCD00617944      ------------------------------------------------------------
NM_004572.3       CTGAGGGAAGCTGGGCCCAGTGTCGCCGTGGATTCCAGCGGGAGGAGAGCGCACTTGACT
                                                                              

HsCD00617944      --------TGAAAACTTATTGGGAAAACAGATTGATCACTTATTCATTAGTAATTTACCA
NM_004572.3       GTCGGCCAGGCGGCCGCAGGGGGAAGTGGGAATCTGCTCACTGAGAGAAGCACTTTCACT
                           *....*  *  *****.: .**:* : *:*: : : * :** *.***..*:

HsCD00617944      GAGATTGTGGTGGAGTTATTGATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAG
NM_004572.3       GACTCCCAGCTGGGGAATGCAGACATGGAGATGACTCTGGAGCGAGCAGTGAGTATGCTC
                  ** :   :* ***.*:::  ..: * * :..: .. * .*....: *:.  .  *  *: 

HsCD00617944      AGCACTGACCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCATTTT
NM_004572.3       GAGGCAGACCACATGCTGCCATCCAGGATTTCTGCTGCAGCTACTTTCATACAGCACGAG
                  .. .*:****:*:   :   :**..**.:**  *.* *:***.**:: . **. **  : 

HsCD00617944      CCATCGCATGTGGTTAAAGCAACATTTGCCTATATCAG----------------------
NM_004572.3       TGCTTCCAGAAATCTGAAGCTCGGAAGAGGGTTAACCAGCTTCGTGGCATCCTCAAGCTT
                    .*  ** .:.  *.****:. .:: .   :**:*..                      

HsCD00617944      --CAATTGTCATAAAACCAAGTTAAAAAGCATTTTAGAAATTCTTTCCAAAAGCCCTGAT
NM_004572.3       CTGCAGCTCCTAAAAGTTCAGAATGAAGACGTTCAGCGAGCTGTGTGTGGGGCCTTGAGA
                     .*    *::***.  .**:::.**..*.** :. .*. * * *  .... *   ..:

HsCD00617944      TCCTATCAGAAAATTCTTCTTGCCATATGTGAGCAAGCAGCTGAAACAAATAATGTTTAT
NM_004572.3       AACTTAGTATTTGAAGACAATGACAACAAATTGGAGGTGGCTGAACTAAATGGGGTACCT
                  :.**:: :.:::.:: : .:**.**:.:.: :* *.* .******. ****.. **: .*

HsCD00617944      AAGAAGCACAGAATTCTTAAAATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATA
NM_004572.3       CGGCTGCTCCAGGTGCTGAAGCAAACCAGAGACTTGGAGACTAAAAAACAAATAACAGAC
                  ..*.:**:*....* ** **..:*:. ... : ** *: * *::*::**:.*:*..:.:.

HsCD00617944      AAAAGTGGCTTAGGAGGAGCTTGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATT
NM_004572.3       CATACAGTCAATTTAAGAAGTAGGAATGGCTGGCCGGGCGCGGTGGCTCACGCCTGTAAT
                  .*:* :* *:::  *.**. *:**..       *   *.*. ** . * * .* *  *:*

HsCD00617944      CACTATATCAACCAAAGGAAATTAACCATTTTCTCTCAGTAAGTGTTTATGATGCACTTC
NM_004572.3       CCCAGCACTTTGGGAGGCCAAGGCGGGCGGATCACGAGGTCAGGAGTTCGAGACCAGCCT
                  *.*:. *  ::  .*.* .**  ..  .  :**:* ..**.** . **. ..: **    

HsCD00617944      CATTGACAAGACTTGAAGGACTAAAG------GATCTTCGAAGACAACTGGAACTACATA
NM_004572.3       GACCAACATGGTTTGCTGTGGAATTTGTCATCTAATGACAAACTCAAGAATCTCATGATA
                   *  .***:*. ***.:* . :*::        *:  :*.** :*** :. .:*:: ***

HsCD00617944      AAGATCAGATGGTGGACATTATGAGAGCTTCTCAGGGTGCTAATTTTAAATGACATGGGC
NM_004572.3       ACAGAAGCATTGCTTACGCTGACGGAGAATATCATCATCCCCTTTTCTGGGTGGCCTGAA
                  *...:.. ** *   **. *.: .***.:*.***  .* * .:*** :..  . .  *..

HsCD00617944      TATTTCTACCTGTTTCTTTTTGAAAGAATATTTTGCAAAGTCTTGCTCTTGGTTTCATTG
NM_004572.3       GGAGACTACCCAAAAGCAAATGGTTTGCTCGATTTTGACATATTCTACAACGTCACTGGA
                   .: :***** .:::  :::**.:: ..*. :**  .*..*.**  :*:: ** :*:  .

HsCD00617944      TCACAGACTTAGTTCAGACTCTCATCATTTAGTTCAG----------ACCCTCATTTCTC
NM_004572.3       TGCCTAAGAAACATGAGTTCTGCTGGCGCTGATGGGAGAAAAGCGATGAGAAGATGTGAC
                  * .*:.* ::* :* **:    *:  .  *..*  ..          .. .: ** * :*

HsCD00617944      ATCTAACTGTAAAACTGGTCCTAACTGGTCTTCTCACCCTGAACTCTTCCTGTTTTATTC
NM_004572.3       GGACTCATTGACTCACTGGTCCATTATGTCAGAGGAACCATTGCAGATTACCAGCCAGAT
                  . . :..*  *.:..  *  * *: : ***: .  *.**: :.*: :* .  :   * : 

HsCD00617944      ATCCTCTGCCAGATGATTTCTCTAAACCCAAATATGATCATGTTTTTCTACTGCCTAAAT
NM_004572.3       GACAAGGCCACGGAGAATTGTGTGTGCATTCTTCATAACCTCTCCTACCAGCTGGAGGCA
                  .:*.:   *..*.:**:** * *.:.*. :.:*.: *:*.* *  *:* *     :...:

HsCD00617944      TTTTTTTTTAAGAGACAGAGTTTTTTTTTTTTTTTAAGAGTCTCACTCTGTCACCTAGGC
NM_004572.3       GAGCTCCCAGAGAAATATTCCCAGAATATCTATATTCAAAACCGGAATATCCAGACTGAC
                   :  *   :.***.* * :   : ::*:* *:*:*:..*.:*  ..: :  ** . :*.*

HsCD00617944      TGGAGTGTAGTGGCACCATCATAACTTACTATGACCTTGAATTCCTGGGTACAAGGAATT
NM_004572.3       AACAACAAAAGTATTGGATGTTTTGGCAGTCGAAGCAGGAAAGTAAAAGAGCAATACCAG
                  :. *. .:*.  . :  ** :*::   * *. .* *: ***:  .:..*:.*** ...: 

HsCD00617944      CTCCTGTCTCAGCCTTCTGAATAGCTGGAACAACAGG---------------CACACACC
NM_004572.3       GACGTGCCGATGCCGGAGGAAAAGAGCAACCCCAAGGGCGTGGAGTGGCTGTGGCATTCC
                   :* ** * .:***  . ***:**.  .*.*...***                .** :**

HsCD00617944      ACTACACCTAGCTACTTTATTTATTTTTTTTATTTTTTGTAGGGACAGGGGTCCCACTAT
NM_004572.3       ATTGTTATAAGGATGTATCTGTCCTTGATCGCCAAAAGTGTCCGCAACTACACACAAGAA
                  * *. :. :** :: *:*.* *. ** :*  . ::::   :  *..*  . :*.**. *:

HsCD00617944      GTTGCCTAGGTTGGTCTCGAATTCTTGGCCTCAAGTGATCCTCCTGCCTTAGCCTCACAA
NM_004572.3       GCATCCTTAGGAGCTCTGCAGAACCTCACGGCCGGAAGTGGACCAATGCCGACATCAGTG
                  * : ***:.* :* ***  *.::* * .*  *..*:..*  :**:.    ..*.*** :.

HsCD00617944      AGCATTGGGATTAGAGGTGTGAGCCACGGCATCTAGCCATGCTTAAACATTTTTCATTTC
NM_004572.3       GCTCAGACAGTTGTCCAGAAGGAAAGTGGCCTGCAGCACACCCGAAAGATGCTGCATGTT
                  .  .: . ..**. . . .:*..... ***.*  ***..: *  *** **  * *** * 

HsCD00617944      TTTTTCTTTTTTTTTAAGACGGAG-------------------TTTCGCTCTTGTTGCCC
NM_004572.3       GGTGACCCAAGTGTGAAAAAGACAGCCATCTCGCTGCTGAGGAATCTGTCCCGGAATCTT
                    * :*  :: * * **.*.*...                   :*  *  *  *:: *  

HsCD00617944      AGGCTGGAATGCAGTGGCACTATCTTAGCTCACTGCAACCTCCACCTCCTGAGCTCAGAT
NM_004572.3       TCTCTGCAGAATGAAATTGCCAAAGAAACTCTCCCTGATTTGGTTTCCATCATTCCTGAC
                  :  *** *.:. ..:.  .* *:. :*.***:*   .*  *  :   *.* *   *:** 

HsCD00617944      TCTCGTGCCTCAGCCTTCCTAGTAGCTAGGATTACAGGCACCTGCCACCATGCCTG--GC
NM_004572.3       ACAGTCCCGAGTACTGACCTTCTCATTGAAACTACAGCCTCTGCCTGTTACACATTGAAC
                  :*:    * : :.*  :***: *.. *...* ***** *:*   * .  * .*.*   .*

HsCD00617944      TAATTTTTTGTATTTTTTTTAGTAGAGACGGGGTTTCACCATGTTGGCCAGGGTGGTCTC
NM_004572.3       AACATAATCCAAAACAGTTACCAGAATGCACGCGACCTTCTAAACACCGGGGGCATCCAG
                  :*.:*::*  :*:: : **:. :..* .*. *  : *: *::.: . * .*** .  *: 

HsCD00617944      AAACTCCTGAGCTCAGGCAATCCGCCCACCTCAGCCTCCCAAAGTGCTGGGATTACAGGC
NM_004572.3       AAAATTATGGCCATTAGTGCAGGCGATGCCTATGCCTCCAACAAAGCAAGTAAAGCTGCT
                  ***.* .**. *: :.* ..:    . .***.:******.*.*.:**:.* *::.*:*  

HsCD00617944      ATGAGCCACCGCGGCTGGCCCATGCTTAAACATTTTTAACACCTTCCAACCATGTAAAAA
NM_004572.3       TCCGTCCTTCTGTATTCTCTGTGGGCACACACGGAACTGCATCATGCCTACAAGAAGGCT
                  :  . **: *   . *  *  : *  :.*...  :: :.** *:* *.:.**:*:*...:

HsCD00617944      AAAAAAAAAAAAAAAAAAAAAAAAA-----------------------------------
NM_004572.3       CAGTTTAAGAAGACAGATTTTGTCAACAGCCGGACTGCCAAAGCCTACCACTCCCTTAAA
                  .*.:::**.**.*.*.*::::.:.*                                   

HsCD00617944      ------
NM_004572.3       GACTGA
                        

Pathways

NCI : ATM pathway
NCI : BARD1 signaling events
NCI : Canonical NF-kappaB pathway
NCI : E2F transcription factor network
NCI : Fanconi anemia pathway
NCI : Regulation of Telomerase
NCI : Validated transcriptional targets of deltaNp63 isoforms
NCI : p38 MAPK signaling pathway
NCI : p53 pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cellular Senescence
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Fanconi Anemia pathway
Reactome : G1/S DNA Damage Checkpoints
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of the Fanconi anemia pathway
Reactome : Stabilization of p53
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : G1 to S cell cycle control
WikiPathway : Homologous recombination
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Ovarian Infertility Genes
WikiPathway : TP53 network
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

UniProt : Q13315
HPRD : 04177

Clone

Cloning Information : 653872
HIP Master Clone ID : 57093
IMAGE ID : 3950747
Original Clone ID : HsCD00298552
Original Clone ID : HsCD00298738
Original Clone ID : FLH230674.01L
Original Clone ID : HsCD00299158
Original Clone ID : FLH230886.01X
Original Clone ID : FLH232151.01L

Organism


TAX_ID : 9606
Species Specific ID: 472

Genome

Chromosome : 12
Map Location : 12p11
Ensembl : ENSG00000057294

Reagents

Labome : ATM-antibody