DNASU Plasmid Repository • 480.965.5697 | Email

TJP2 (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TJP2
Gene Name:  tight junction protein 2
Sequence             
Original Clone ID: FLH231558.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00617962

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3573nts         Open reading frame : 210 to 3782
Reference Sequence Alignment

AGCGGAGGGGCCACGCTCGGGTCGGGGGCGGGCTGACGCCGCCGCCGCCGCGGGAGGAGG
GACAAAGGGGTGGGTCCCCGCGGGTCGGCACCCCGGCGGTTGGGCTGCGGGTCAGAGCAC
TGTCCGGTGGTGCCCAGGAGGAGTAGGAGCAGGAGCAGAAGCAGAAGCGGGGTCCGGAGC
TGCGCGCCTACGCGGGACCTGTGTCCGAAATGCCGGTGCGAGGAGACCGCGGGTTTCCAC
CCCGGCGGGAGCTGTCAGGTTGGCTCCGCGCCCCAGGCATGGAAGAGCTGATATGGGAAC
AGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTTGGAATTGCAGTGTCCGGAG
GCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATTGTCATTTCTGATGTGCTCC
CGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGAGTGGTCATGGTCAATGGCA
CCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAGCTCAGAAAAAGTGGGAAGG
TCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTGGCCGCACTTCAGGCCAGCC
CTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGACGAGTTTGATGGCAGAAGTT
TCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCATGGGGGGCGCAGCCGCAGCT
GGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCCCGGAGCCGGGAGCGGGACC
TCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGCCTGGACCAAGACCATGCGC
GCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGCCTGGACCACGACTTTGGGC
CATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGCATTGACCAGGACTACGAGC
GAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCCTACAGCCCGGAGTACAGGC
GCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGCCGCAGCCGCGAGCACCCGC
ACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGGCCCATCGGGGTCCTCCTGA
TGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGGAGTCAGATCTTCGTAAAGG
AAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTTCACGAAGGAGACATAATTC
TCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACGGATGCTCGAAAATTGATAG
AAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGACAGCCAGCAGACCCTCATCA
ACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGATATTTCAGAAATAGAGTCAA
ACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCTGATTATGATTATCATTCCT
CAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGACACGCCGAGCAGATTGTCCA
GGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGATATTGCAGGCACAGTTGTCC
CAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCAGCTCCTCAACCAAAAGCAG
CCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCAATATATGGCCCTAATACCA
AAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGGTTGGCTGGTGGCAATGATG
TCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCGGAGCAGGAGGGCCTTCAAG
AAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGAGGATTAGTGCGGGAGGATG
CCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTGACCATTTTAGCTCAGAGCC
GAGCTGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGGGATTCGTTTTTTATAAGAA
GCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCCTTCACCAGAGGGGAGGTCT
TCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAACTGGCTGGCTGTGAGGATTG
GGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGAGCTGAACAAATGGCCAGTG
TTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGATTTCTGGAGAATGCGTGGCC
AGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAAGACCTCACAGCTGTTGTGT
CTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTGCGAGAAGCTGGTTTCAAGA
GACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATGGAAAAATTGGCTAATGAGT
TACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGATGCAGGATCTGAGAAATCCA
CTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAGCAGGATAAGCATGCACTAC
TGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACCCAGTGGTTCCCAATTGTGA
TTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATGAGACAAAGGTTAAATCCAA
CGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAACAAGCTTAAAAAAACGTGTG
CACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAATGATAGCTGGTTTGGCAGCT
TAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGGGTCTCTGAAGGAAAGATGG
AAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTAACCGCCATGGGCGCGGACT
ATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGACACGGACGGTGAAGGAGGCG
CCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCGCTGGTGTCGTCCATCACCC
GCTCCTCGGAGCCGGTGCAGCACGAGGAGAGCATAAGGAAACCCAGCCCAGAGCCACGAG
CTCAGATGAGGAGGGCTGCTAGCAGCGATCAACTTAGGGACAATAGCCCGCCCCCAGCAT
TCAAGCCAGAGCCGCCCAAGGCCAAAACCCAGAACAAAGAAGAATCCTATGACTTCTCCA
AATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGTAATGAAACTCCTGGGGCAT
CTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACCTTTGGGCGGTCTATACTGA
AGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTGGGAGAGAGCAGTGAGGAGC
AAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATATTTGAGAAGATGGATCACA
AGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAGAATGCAAGGATCGAAATTG
CCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACGCACAAGCCAGACCCTGGCA
CGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAAGCTCCTTCCAGACCTTATC
AGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAGGAGTACCGCCAGCAGCTGT
CAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGATACCGGGACACAGAATTAT
AGATGTCTGAGCACGGACTCTCCCAGGCCTGCCTGCATGGCATCAGACTAGCCACTCCTG
CCAGGCCGCCGGGATGGTTCTTCTCCAGTTAGAATGCACCATGGAGACGTGGTGGGACTC
CAGCTCGTGTGTCCTCATGGAGAACCCAGGGGACAGCTGGTGCAAATTCAGAACTGAGGG
CTCTGTTTGTGGGACTGGGTTAGAGGAGTCTGTGGCTTTTTGTTCAGAATTAAGCAGAAC
ACTGCAGTCAGATCCTGTTACTTGCTTCAGTGGACCGAAATCTGTATTCTGTTTGCGTAC
TTGTAATATGTATATTAAGAAGCAATAACTATTTTTCCTCATTAATAGCTGCCTTCAAGG
ACTGTTTCAGTGTGAGTCAGAATGTGAAAAAGGAATAAAAAAATACTGTTGGGCTCAAAC
TAAATTCAAAGAAGTACTTTATTGCAACTCTTTTAAGTGCCTTGGATGAGAAGTGTCTTA
AATTTTCTTCCTTTGAAGCTTTAGGCAGAGCCATAATGGACTAAAACATTTTGACTAAGT
TTTTATACCAGCTTAATAGCTGTAGTTTTCCCTGCACTGTGTCATCTTTTCAAGGCATTT
GTCTTTGTAATATTTTCCATAATTTTGGACTGTCTATATCATAACTATACTTGATAGTTT
GGCTATAAGTGCTCAATAGCTTGAAGCCCAAGAAGTTGGTATCGAAATTTGTTGTTTGTT
TAAACCCAAGTGCTGCACAAAAGCAGATACTTGAGGAAAACACTATTTCCAAAAGCACAT
GTATTGACAACAGTTTTATAATTTAATAAAAAGGAATACATTACAAAAAAAAAAAAAAAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TJP2
Symbol Nomenclature : TJP2
SYNONYM : C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2
Designation : Friedreich ataxia region gene X104 (tight junction protein ZO-2)|tight junction protein ZO-2|zona occludens 2|zonula occludens protein 2
Full Nomenclature : tight junction protein 2
GENEID : 9414
Locus Tag : RP11-16N10.1
HGNC : 11828
MIM : 607709
Vega : OTTHUMG00000019978
Target GenBank: BC027592

 

Reference Sequence Alignment

  

HsCD00617962        AGCGGAGGGGCCACGCTCGGGTCGGGGGCGGGCTGACGCCGCCGCCGCCGCGGGAGGAGG
XM_005252313.1      --------------------------------ATGAGGTACAAGAAATATATCGGTATTC
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      --------------------------------ATGAGGTACAAGAAATATATCGGTATTC
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        GACAAAGGGGTGGGTCCCCGCGGGTCGGCACCCCGGCGGTTGGGCTGCGGGTCAGAGCAC
XM_005252313.1      TGGAAGCAGCAGTTGGTATTACCCCACTTAACAAAAGAGAACTTCTACCTGAGAGCAGAA
NM_001170416.1      --------------------------------------------------------ATGA
XM_005252311.1      TGGAAGCAGCAGTTGGTATTACCCCACTTAACAAAAGAGAACTTCTACCTGAGAGCAGAA
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        TGTCCGGTGGTGCCCAGGAGGAGTAGGAGCAGGAGCAGAAGCAGAAGCGGGGTCCGGAGC
XM_005252313.1      GACACGTGAACCTTTGGCAACAACCTGGGGTGCGAAGTACCACATTACTGTCATCTCCCT
NM_001170416.1      AGACTGCTCAAGCCCTACATAGGATGTGGATCCAGGCTGTTAAAAAGTTGAGGAGATGGA
XM_005252311.1      GACACGTGAACCTTTGGCAACAACCTGGGGTGCGAAGTACCACATTACTGTCATCTCCCT
XM_005252312.1      --------------------ATGGCTGGGGTGCGAAGTACCACATTACTGTCATCTCCCT
                                          .    .* :  ..   .  ...::.  *          

HsCD00617962        TGCGCGCCTACGCGGGACCTGTGTCCGAAATGCCGGTGCGAGGAGACCGCGGGTTTCCAC
XM_005252313.1      GTGAGTGGGATTGGCACCCCGGCTGCAGCTCCAGGAGCAAGTACTCCAGGAAGCACAGAG
NM_001170416.1      AAGGCCGTGTGAGTCCCTCTGCAAGCTCTCCCCTTGTTTTCCCCAACCTTTCTTCATGGG
XM_005252311.1      GTGAGTGGGATTGGCACCCCGGCTGCAGCTCCAGGAGCAAGTACTCCAGGAAGCACAGAG
XM_005252312.1      GTGAGTGGGATTGGCACCCCGGCTGCAGCTCCAGGAGCAAGTACTCCAGGAAGCACAGAG
                       .     :      . * *  : *      .  .       . .*.          . 

HsCD00617962        CCCGGCGGGAGCTGTCAGGTTGGCTCCGCGCCCCAGGCATGGAAGAGCTGATATGGGAAC
XM_005252313.1      CTGTACCAGTACACGGCCCACGTTGCCAGGCCCCAGGCATGGAAGAGCTGATATGGGAAC
NM_001170416.1      AAGGGGAGGGAAGCAAAACCATTCTCACAGCCCCAGGCATGGAAGAGCTGATATGGGAAC
XM_005252311.1      CTGTACCAGTACACGGCCCACGTTGCCAGGCCCCAGGCATGGAAGAGCTGATATGGGAAC
XM_005252312.1      CTGTACCAGTACACGGCCCACGTTGCCAGGCCCCAGGCATGGAAGAGCTGATATGGGAAC
                    .   .  .* ..    .        *.  *******************************

HsCD00617962        AGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTTGGAATTGCAGTGTCCGGAG
XM_005252313.1      AGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTTGGAATTGCAGTGTCCGGAG
NM_001170416.1      AGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTTGGAATTGCAGTGTCCGGAG
XM_005252311.1      AGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTTGGAATTGCAGTGTCCGGAG
XM_005252312.1      AGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTTGGAATTGCAGTGTCCGGAG
                    ************************************************************

HsCD00617962        GCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATTGTCATTTCTGATGTGCTCC
XM_005252313.1      GCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATTGTCATTTCTGATGTGCTCC
NM_001170416.1      GCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATTGTCATTTCTGATGTGCTCC
XM_005252311.1      GCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATTGTCATTTCTGATGTGCTCC
XM_005252312.1      GCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATTGTCATTTCTGATGTGCTCC
                    ************************************************************

HsCD00617962        CGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGAGTGGTCATGGTCAATGGCA
XM_005252313.1      CGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGAGTGGTCATGGTCAATGGCA
NM_001170416.1      CGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGAGTGGTCATGGTCAATGGCA
XM_005252311.1      CGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGAGTGGTCATGGTCAATGGCA
XM_005252312.1      CGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGAGTGGTCATGGTCAATGGCA
                    ************************************************************

HsCD00617962        CCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAGCTCAGAAAAAGTGGGAAGG
XM_005252313.1      CCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAGCTCAGAAAAAGTGGGAAGG
NM_001170416.1      CCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAGCTCAGAAAAAGTGGGAAGG
XM_005252311.1      CCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAGCTCAGAAAAAGTGGGAAGG
XM_005252312.1      CCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAGCTCAGAAAAAGTGGGAAGG
                    ************************************************************

HsCD00617962        TCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTGGCCGCACTTCAGGCCAGCC
XM_005252313.1      TCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTGGCCGCACTTCAGGCCAGCC
NM_001170416.1      TCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTGGCCGCACTTCAGGCCAGCC
XM_005252311.1      TCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTGGCCGCACTTCAGGCCAGCC
XM_005252312.1      TCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTGGCCGCACTTCAGGCCAGCC
                    ************************************************************

HsCD00617962        CTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGACGAGTTTGATGGCAGAAGTT
XM_005252313.1      CTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGACGAGTTTGATGGCAGAAGTT
NM_001170416.1      CTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGACGAGTTTGATGGCAGAAGTT
XM_005252311.1      CTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGACGAGTTTGATGGCAGAAGTT
XM_005252312.1      CTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGACGAGTTTGATGGCAGAAGTT
                    ************************************************************

HsCD00617962        TCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCATGGGGGGCGCAGCCGCAGCT
XM_005252313.1      TCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCATGGGGGGCGCAGCCGCAGCT
NM_001170416.1      TCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCATGGGGGGCGCAGCCGCAGCT
XM_005252311.1      TCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCATGGGGGGCGCAGCCGCAGCT
XM_005252312.1      TCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCATGGGGGGCGCAGCCGCAGCT
                    ************************************************************

HsCD00617962        GGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCCCGGAGCCGGGAGCGGGACC
XM_005252313.1      GGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCCCGGAGCCGGGAGCGGGACC
NM_001170416.1      GGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCCCGGAGCCGGGAGCGGGACC
XM_005252311.1      GGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCCCGGAGCCGGGAGCGGGACC
XM_005252312.1      GGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCCCGGAGCCGGGAGCGGGACC
                    ************************************************************

HsCD00617962        TCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGCCTGGACCAAGACCATGCGC
XM_005252313.1      TCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGCCTGGACCAAGACCATGCGC
NM_001170416.1      TCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGCCTGGACCAAGACCATGCGC
XM_005252311.1      TCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGCCTGGACCAAGACCATGCGC
XM_005252312.1      TCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGCCTGGACCAAGACCATGCGC
                    ************************************************************

HsCD00617962        GCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGCCTGGACCACGACTTTGGGC
XM_005252313.1      GCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGCCTGGACCACGACTTTGGGC
NM_001170416.1      GCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGCCTGGACCACGACTTTGGGC
XM_005252311.1      GCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGCCTGGACCACGACTTTGGGC
XM_005252312.1      GCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGCCTGGACCACGACTTTGGGC
                    ************************************************************

HsCD00617962        CATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGCATTGACCAGGACTACGAGC
XM_005252313.1      CATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGCATTGACCAGGACTACGAGC
NM_001170416.1      CATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGCATTGACCAGGACTACGAGC
XM_005252311.1      CATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGCATTGACCAGGACTACGAGC
XM_005252312.1      CATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGCATTGACCAGGACTACGAGC
                    ************************************************************

HsCD00617962        GAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCCTACAGCCCGGAGTACAGGC
XM_005252313.1      GAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCCTACAGCCCGGAGTACAGGC
NM_001170416.1      GAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCCTACAGCCCGGAGTACAGGC
XM_005252311.1      GAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCCTACAGCCCGGAGTACAGGC
XM_005252312.1      GAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCCTACAGCCCGGAGTACAGGC
                    ************************************************************

HsCD00617962        GCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGCCGCAGCCGCGAGCACCCGC
XM_005252313.1      GCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGCCGCAGCCGCGAGCACCCGC
NM_001170416.1      GCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGCCGCAGCCGCGAGCACCCGC
XM_005252311.1      GCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGCCGCAGCCGCGAGCACCCGC
XM_005252312.1      GCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGCCGCAGCCGCGAGCACCCGC
                    ************************************************************

HsCD00617962        ACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGGCCCATCGGGGTCCTCCTGA
XM_005252313.1      ACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGGCCCATCGGGGTCCTCCTGA
NM_001170416.1      ACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGGCCCATCGGGGTCCTCCTGA
XM_005252311.1      ACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGGCCCATCGGGGTCCTCCTGA
XM_005252312.1      ACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGGCCCATCGGGGTCCTCCTGA
                    ************************************************************

HsCD00617962        TGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGGAGTCAGATCTTCGTAAAGG
XM_005252313.1      TGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGGAGTCAGATCTTCGTAAAGG
NM_001170416.1      TGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGGAGTCAGATCTTCGTAAAGG
XM_005252311.1      TGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGGAGTCAGATCTTCGTAAAGG
XM_005252312.1      TGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGGAGTCAGATCTTCGTAAAGG
                    ************************************************************

HsCD00617962        AAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTTCACGAAGGAGACATAATTC
XM_005252313.1      AAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTTCACGAAGGAGACATAATTC
NM_001170416.1      AAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTTCACGAAGGAGACATAATTC
XM_005252311.1      AAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTTCACGAAGGAGACATAATTC
XM_005252312.1      AAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTTCACGAAGGAGACATAATTC
                    ************************************************************

HsCD00617962        TCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACGGATGCTCGAAAATTGATAG
XM_005252313.1      TCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACGGATGCTCGAAAATTGATAG
NM_001170416.1      TCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACGGATGCTCGAAAATTGATAG
XM_005252311.1      TCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACGGATGCTCGAAAATTGATAG
XM_005252312.1      TCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACGGATGCTCGAAAATTGATAG
                    ************************************************************

HsCD00617962        AAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGACAGCCAGCAGACCCTCATCA
XM_005252313.1      AAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGACAGCCAGCAGACCCTCATCA
NM_001170416.1      AAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGACAGCCAGCAGACCCTCATCA
XM_005252311.1      AAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGACAGCCAGCAGACCCTCATCA
XM_005252312.1      AAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGACAGCCAGCAGACCCTCATCA
                    ************************************************************

HsCD00617962        ACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGATATTTCAGAAATAGAGTCAA
XM_005252313.1      ACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGATATTTCAGAAATAGAGTCAA
NM_001170416.1      ACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGATATTTCAGAAATAGAGTCAA
XM_005252311.1      ACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGATATTTCAGAAATAGAGTCAA
XM_005252312.1      ACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGATATTTCAGAAATAGAGTCAA
                    ************************************************************

HsCD00617962        ACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCTGATTATGATTATCATTCCT
XM_005252313.1      ACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCTGATTATGATTATCATTCCT
NM_001170416.1      ACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCTGATTATGATTATCATTCCT
XM_005252311.1      ACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCTGATTATGATTATCATTCCT
XM_005252312.1      ACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCTGATTATGATTATCATTCCT
                    ************************************************************

HsCD00617962        CAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGACACGCCGAGCAGATTGTCCA
XM_005252313.1      CAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGACACGCCGAGCAGATTGTCCA
NM_001170416.1      CAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGACACGCCGAGCAGATTGTCCA
XM_005252311.1      CAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGACACGCCGAGCAGATTGTCCA
XM_005252312.1      CAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGACACGCCGAGCAGATTGTCCA
                    ************************************************************

HsCD00617962        GGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGATATTGCAGGCACAGTTGTCC
XM_005252313.1      GGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGATATTGCAGGCACAGTTGTCC
NM_001170416.1      GGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGATATTGCAGGCACAGTTGTCC
XM_005252311.1      GGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGATATTGCAGGCACAGTTGTCC
XM_005252312.1      GGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGATATTGCAGGCACAGTTGTCC
                    ************************************************************

HsCD00617962        CAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCAGCTCCTCAACCAAAAGCAG
XM_005252313.1      CAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCAGCTCCTCAACCAAAAGCAG
NM_001170416.1      CAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCAGCTCCTCAACCAAAAGCAG
XM_005252311.1      CAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCAGCTCCTCAACCAAAAGCAG
XM_005252312.1      CAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCAGCTCCTCAACCAAAAGCAG
                    ************************************************************

HsCD00617962        CCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCAATATATGGCCCTAATACCA
XM_005252313.1      CCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCAATATATGGCCCTAATACCA
NM_001170416.1      CCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCAATATATGGCCCTAATACCA
XM_005252311.1      CCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCAATATATGGCCCTAATACCA
XM_005252312.1      CCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCAATATATGGCCCTAATACCA
                    ************************************************************

HsCD00617962        AAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGGTTGGCTGGTGGCAATGATG
XM_005252313.1      AAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGGTTGGCTGGTGGCAATGATG
NM_001170416.1      AAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGGTTGGCTGGTGGCAATGATG
XM_005252311.1      AAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGGTTGGCTGGTGGCAATGATG
XM_005252312.1      AAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGGTTGGCTGGTGGCAATGATG
                    ************************************************************

HsCD00617962        TCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCGGAGCAGGAGGGCCTTCAAG
XM_005252313.1      TCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCGGAGCAGGAGGGCCTTCAAG
NM_001170416.1      TCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCGGAGCAGGAGGGCCTTCAAG
XM_005252311.1      TCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCGGAGCAGGAGGGCCTTCAAG
XM_005252312.1      TCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCGGAGCAGGAGGGCCTTCAAG
                    ************************************************************

HsCD00617962        AAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGAGGATTAGTGCGGGAGGATG
XM_005252313.1      AAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGAGGATTAGTGCGGGAGGATG
NM_001170416.1      AAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGAGGATTAGTGCGGGAGGATG
XM_005252311.1      AAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGAGGATTAGTGCGGGAGGATG
XM_005252312.1      AAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGAGGATTAGTGCGGGAGGATG
                    ************************************************************

HsCD00617962        CCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTGACCATTTTAGCTCAGAGCC
XM_005252313.1      CCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTGACCATTTTAGCTCAGAGCC
NM_001170416.1      CCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTGACCATTTTAGCTCAGAGCC
XM_005252311.1      CCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTGACCATTTTAGCTCAGAGCC
XM_005252312.1      CCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTGACCATTTTAGCTCAGAGCC
                    ************************************************************

HsCD00617962        GAGCTGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGGGATTCGTTTTTTATAAGAA
XM_005252313.1      GAGCCGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGGGATTCGTTTTTTATAAGAA
NM_001170416.1      GAGCCGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGGGATTCGTTTTTTATAAGAA
XM_005252311.1      GAGCCGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGGGATTCGTTTTTTATAAGAA
XM_005252312.1      GAGCCGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGGGATTCGTTTTTTATAAGAA
                    **** *******************************************************

HsCD00617962        GCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCCTTCACCAGAGGGGAGGTCT
XM_005252313.1      GCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCCTTCACCAGAGGGGAGGTCT
NM_001170416.1      GCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCCTTCACCAGAGGGGAGGTCT
XM_005252311.1      GCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCCTTCACCAGAGGGGAGGTCT
XM_005252312.1      GCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCCTTCACCAGAGGGGAGGTCT
                    ************************************************************

HsCD00617962        TCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAACTGGCTGGCTGTGAGGATTG
XM_005252313.1      TCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAACTGGCTGGCTGTGAGGATTG
NM_001170416.1      TCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAACTGGCTGGCTGTGAGGATTG
XM_005252311.1      TCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAACTGGCTGGCTGTGAGGATTG
XM_005252312.1      TCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAACTGGCTGGCTGTGAGGATTG
                    ************************************************************

HsCD00617962        GGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGAGCTGAACAAATGGCCAGTG
XM_005252313.1      GGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGAGCTGAACAAATGGCCAGTG
NM_001170416.1      GGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGAGCTGAACAAATGGCCAGTG
XM_005252311.1      GGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGAGCTGAACAAATGGCCAGTG
XM_005252312.1      GGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGAGCTGAACAAATGGCCAGTG
                    ************************************************************

HsCD00617962        TTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGATTTCTGGAGAATGCGTGGCC
XM_005252313.1      TTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGATTTCTGGAGAATGCGTGGCC
NM_001170416.1      TTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGATTTCTGGAGAATGCGTGGCC
XM_005252311.1      TTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGATTTCTGGAGAATGCGTGGCC
XM_005252312.1      TTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGATTTCTGGAGAATGCGTGGCC
                    ************************************************************

HsCD00617962        AGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAAGACCTCACAGCTGTTGTGT
XM_005252313.1      AGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAAGACCTCACAGCTGTTGTGT
NM_001170416.1      AGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAAGACCTCACAGCTGTTGTGT
XM_005252311.1      AGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAAGACCTCACAGCTGTTGTGT
XM_005252312.1      AGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAAGACCTCACAGCTGTTGTGT
                    ************************************************************

HsCD00617962        CTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTGCGAGAAGCTGGTTTCAAGA
XM_005252313.1      CTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTGCGAGAAGCTGGTTTCAAGA
NM_001170416.1      CTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTGCGAGAAGCTGGTTTCAAGA
XM_005252311.1      CTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTGCGAGAAGCTGGTTTCAAGA
XM_005252312.1      CTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTGCGAGAAGCTGGTTTCAAGA
                    ************************************************************

HsCD00617962        GACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATGGAAAAATTGGCTAATGAGT
XM_005252313.1      GACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATGGAAAAATTGGCTAATGAGT
NM_001170416.1      GACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATGGAAAAATTGGCTAATGAGT
XM_005252311.1      GACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATGGAAAAATTGGCTAATGAGT
XM_005252312.1      GACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATGGAAAAATTGGCTAATGAGT
                    ************************************************************

HsCD00617962        TACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGATGCAGGATCTGAGAAATCCA
XM_005252313.1      TACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGATGCAGGATCTGAGAAATCCA
NM_001170416.1      TACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGATGCAGGATCTGAGAAATCCA
XM_005252311.1      TACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGATGCAGGATCTGAGAAATCCA
XM_005252312.1      TACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGATGCAGGATCTGAGAAATCCA
                    ************************************************************

HsCD00617962        CTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAGCAGGATAAGCATGCACTAC
XM_005252313.1      CTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAACAGGATAAGCATGCACTAC
NM_001170416.1      CTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAACAGGATAAGCATGCACTAC
XM_005252311.1      CTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAACAGGATAAGCATGCACTAC
XM_005252312.1      CTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAACAGGATAAGCATGCACTAC
                    ****************************************.*******************

HsCD00617962        TGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACCCAGTGGTTCCCAATTGTGA
XM_005252313.1      TGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACCCAGTGGTTCCCAATTGTGA
NM_001170416.1      TGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACCCAGTGGTTCCCAATTGTGA
XM_005252311.1      TGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACCCAGTGGTTCCCAATTGTGA
XM_005252312.1      TGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACCCAGTGGTTCCCAATTGTGA
                    ************************************************************

HsCD00617962        TTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATGAGACAAAGGTTAAATCCAA
XM_005252313.1      TTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATGAGACAAAGGTTAAATCCAA
NM_001170416.1      TTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATGAGACAAAGGTTAAATCCAA
XM_005252311.1      TTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATGAGACAAAGGTTAAATCCAA
XM_005252312.1      TTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATGAGACAAAGGTTAAATCCAA
                    ************************************************************

HsCD00617962        CGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAACAAGCTTAAAAAAACGTGTG
XM_005252313.1      CGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAACAAGCTTAAAAAAACGTGTG
NM_001170416.1      CGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAACAAGCTTAAAAAAACGTGTG
XM_005252311.1      CGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAACAAGCTTAAAAAAACGTGTG
XM_005252312.1      CGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAACAAGCTTAAAAAAACGTGTG
                    ************************************************************

HsCD00617962        CACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAATGATAGCTGGTTTGGCAGCT
XM_005252313.1      CACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAATGATAGCTGGTTTGGCAGCT
NM_001170416.1      CACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAATGATAGCTGGTTTGGCAGCT
XM_005252311.1      CACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAATGATAGCTGGTTTGGCAGCT
XM_005252312.1      CACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAATGATAGCTGGTTTGGCAGCT
                    ************************************************************

HsCD00617962        TAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGGGTCTCTGAAGGAAAGATGG
XM_005252313.1      TAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGGGTCTCTGAAGGAAAGATGG
NM_001170416.1      TAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGGGTCTCTGAAGGAAAGATGG
XM_005252311.1      TAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGGGTCTCTGAAGGAAAGATGG
XM_005252312.1      TAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGGGTCTCTGAAGGAAAGATGG
                    ************************************************************

HsCD00617962        AAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTAACCGCCATGGGCGCGGACT
XM_005252313.1      AAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTAACCGCCATGGGCGCGGACT
NM_001170416.1      AAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTAACCGCCATGGGCGCGGACT
XM_005252311.1      AAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTAACCGCCATGGGCGCGGACT
XM_005252312.1      AAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTAACCGCCATGGGCGCGGACT
                    ************************************************************

HsCD00617962        ATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGACACGGACGGTGAAGGAGGCG
XM_005252313.1      ATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGACACGGACGGTGAAGGAGGCG
NM_001170416.1      ATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGACACGGACGGTGAAGGAGGCG
XM_005252311.1      ATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGACACGGACGGTGAAGGAGGCG
XM_005252312.1      ATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGACACGGACGGTGAAGGAGGCG
                    ************************************************************

HsCD00617962        CCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCGCTGGTGTCGTCCATCACCC
XM_005252313.1      CCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCGCTGGTGTCGTCCATCACCC
NM_001170416.1      CCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCGCTGGTGTCGTCCATCACCC
XM_005252311.1      CCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCGCTGGTGTCGTCCATCACCC
XM_005252312.1      CCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCGCTGGTGTCGTCCATCACCC
                    ************************************************************

HsCD00617962        GCTCCTCGGAGCCGGTGCAGCACGAGGAGAGCATAAGGAAACCCAGCCCAGAGCCACGAG
XM_005252313.1      GCTCCTCGGAGCCGGTGCAGCACGAGGAGG------------------------------
NM_001170416.1      GCTCCTCGGAGCCGGTGCAGCACGAGGAGAGCATAAGGAAACCCAGCCCAGAGCCACGAG
XM_005252311.1      GCTCCTCGGAGCCGGTGCAGCACGAGGAGAGCATAAGGAAACCCAGCCCAGAGCCACGAG
XM_005252312.1      GCTCCTCGGAGCCGGTGCAGCACGAGGAGAGCATAAGGAAACCCAGCCCAGAGCCACGAG
                    *****************************.                              

HsCD00617962        CTCAGATGAGGAGGGCTGCTAGCAGCGATCAACTTAGGGACAATAGCCCGCCCCCAGCAT
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      CTCAGATGAGGAGGGCTGCTAGCAGCGATCAACTTAGGGACAATAGCCCGCCCCCAGCAT
XM_005252311.1      CTCAGATGAGGAGGGCTGCTAGCAGCGATCAACTTAGGGACAATAGCCCGCCCCCAGCAT
XM_005252312.1      CTCAGATGAGGAGGGCTGCTAGCAGCGATCAACTTAGGGACAATAGCCCGCCCCCAGCAT
                                                                                

HsCD00617962        TCAAGCCAGAGCCGCCCAAGGCCAAAACCCAGAACAAAGAAGAATCCTATGACTTCTCCA
XM_005252313.1      ---------------------CCAAAACCCAGAACAAAGAAGAATCCTATGACTTCTCCA
NM_001170416.1      TCAAGCCAGAGCCGCCCAAGGCCAAAACCCAGAACAAAGAAGAATCCTATGACTTCTCCA
XM_005252311.1      TCAAGCCAGAGCCGCCCAAGGCCAAAACCCAGAACAAAGAAGAATCCTATGACTTCTCCA
XM_005252312.1      TCAAGCCAGAGCCGCCCAAGGCCAAAACCCAGAACAAAGAAGAATCCTATGACTTCTCCA
                                         ***************************************

HsCD00617962        AATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGTAATGAAACTCCTGGGGCAT
XM_005252313.1      AATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGTAATGAAACTCCTGGGGCAT
NM_001170416.1      AATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGTAATGAAACTCCTGGGGCAT
XM_005252311.1      AATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGTAATGAAACTCCTGGGGCAT
XM_005252312.1      AATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGTAATGAAACTCCTGGGGCAT
                    ************************************************************

HsCD00617962        CTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACCTTTGGGCGGTCTATACTGA
XM_005252313.1      CTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACCTTTGGGCGGTCTATACTGA
NM_001170416.1      CTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACCTTTGGGCGGTCTATACTGA
XM_005252311.1      CTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACCTTTGGGCGGTCTATACTGA
XM_005252312.1      CTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACCTTTGGGCGGTCTATACTGA
                    ************************************************************

HsCD00617962        AGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTGGGAGAGAGCAGTGAGGAGC
XM_005252313.1      AGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTGGGAGAGAGCAGTGAGGAGC
NM_001170416.1      AGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTGGGAGAGAGCAGTGAGGAGC
XM_005252311.1      AGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTGGGAGAGAGCAGTGAGGAGC
XM_005252312.1      AGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTGGGAGAGAGCAGTGAGGAGC
                    ************************************************************

HsCD00617962        AAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATATTTGAGAAGATGGATCACA
XM_005252313.1      AAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATATTTGAGAAGATGGATCACA
NM_001170416.1      AAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATATTTGAGAAGATGGATCACA
XM_005252311.1      AAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATATTTGAGAAGATGGATCACA
XM_005252312.1      AAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATATTTGAGAAGATGGATCACA
                    ************************************************************

HsCD00617962        AGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAGAATGCAAGGATCGAAATTG
XM_005252313.1      AGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAGAATGCAAGGATCGAAATTG
NM_001170416.1      AGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAGAATGCAAGGATCGAAATTG
XM_005252311.1      AGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAGAATGCAAGGATCGAAATTG
XM_005252312.1      AGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAGAATGCAAGGATCGAAATTG
                    ************************************************************

HsCD00617962        CCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACGCACAAGCCAGACCCTGGCA
XM_005252313.1      CCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACGCACAAGCCAGACCCTGGCA
NM_001170416.1      CCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACGCACAAGCCAGACCCTGGCA
XM_005252311.1      CCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACGCACAAGCCAGACCCTGGCA
XM_005252312.1      CCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACGCACAAGCCAGACCCTGGCA
                    ************************************************************

HsCD00617962        CGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAAGCTCCTTCCAGACCTTATC
XM_005252313.1      CGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAAGCTCCTTCCAGACCTTATC
NM_001170416.1      CGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAAGCTCCTTCCAGACCTTATC
XM_005252311.1      CGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAAGCTCCTTCCAGACCTTATC
XM_005252312.1      CGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAAGCTCCTTCCAGACCTTATC
                    ************************************************************

HsCD00617962        AGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAGGAGTACCGCCAGCAGCTGT
XM_005252313.1      AGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAGGAGTACCGCCAGCAGCTGT
NM_001170416.1      AGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAGGAGTACCGCCAGCAGCTGT
XM_005252311.1      AGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAGGAGTACCGCCAGCAGCTGT
XM_005252312.1      AGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAGGAGTACCGCCAGCAGCTGT
                    ************************************************************

HsCD00617962        CAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGATACCGGGACACAGAATTAT
XM_005252313.1      CAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGATACCGGGACACAGAATTAT
NM_001170416.1      CAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGATACCGGGACACAGAATTAT
XM_005252311.1      CAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGATACCGGGACACAGAATTAT
XM_005252312.1      CAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGATACCGGGACACAGAATTAT
                    ************************************************************

HsCD00617962        AGATGTCTGAGCACGGACTCTCCCAGGCCTGCCTGCATGGCATCAGACTAGCCACTCCTG
XM_005252313.1      AG----------------------------------------------------------
NM_001170416.1      AG----------------------------------------------------------
XM_005252311.1      AG----------------------------------------------------------
XM_005252312.1      AG----------------------------------------------------------
                    **                                                          

HsCD00617962        CCAGGCCGCCGGGATGGTTCTTCTCCAGTTAGAATGCACCATGGAGACGTGGTGGGACTC
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        CAGCTCGTGTGTCCTCATGGAGAACCCAGGGGACAGCTGGTGCAAATTCAGAACTGAGGG
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        CTCTGTTTGTGGGACTGGGTTAGAGGAGTCTGTGGCTTTTTGTTCAGAATTAAGCAGAAC
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        ACTGCAGTCAGATCCTGTTACTTGCTTCAGTGGACCGAAATCTGTATTCTGTTTGCGTAC
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        TTGTAATATGTATATTAAGAAGCAATAACTATTTTTCCTCATTAATAGCTGCCTTCAAGG
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        ACTGTTTCAGTGTGAGTCAGAATGTGAAAAAGGAATAAAAAAATACTGTTGGGCTCAAAC
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        TAAATTCAAAGAAGTACTTTATTGCAACTCTTTTAAGTGCCTTGGATGAGAAGTGTCTTA
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        AATTTTCTTCCTTTGAAGCTTTAGGCAGAGCCATAATGGACTAAAACATTTTGACTAAGT
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        TTTTATACCAGCTTAATAGCTGTAGTTTTCCCTGCACTGTGTCATCTTTTCAAGGCATTT
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        GTCTTTGTAATATTTTCCATAATTTTGGACTGTCTATATCATAACTATACTTGATAGTTT
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        GGCTATAAGTGCTCAATAGCTTGAAGCCCAAGAAGTTGGTATCGAAATTTGTTGTTTGTT
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        TAAACCCAAGTGCTGCACAAAAGCAGATACTTGAGGAAAACACTATTTCCAAAAGCACAT
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00617962        GTATTGACAACAGTTTTATAATTTAATAAAAAGGAATACATTACAAAAAAAAAAAAAAAA
XM_005252313.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
XM_005252311.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

Pathways

NCI : Validated targets of C-MYC transcriptional repression
Reactome : Apoptosis
Reactome : Apoptotic cleavage of cell adhesion proteins
Reactome : Apoptotic cleavage of cellular proteins
Reactome : Apoptotic execution phase
Reactome : Signal Transduction
Reactome : Signaling by Hippo

Protein

SMART domain : GuKc : Guanylate kinase homologues.
SMART domain : PDZ : Domain present in PSD-95, Dlg, and ZO-1/2.
SMART domain : SH3 : Src homology 3 domains
UniProt : B7Z2R8
UniProt : B7Z954
UniProt : B7Z2R3
UniProt : Q9UDY2
UniProt : B7Z7T6
HPRD : 06369

Clone

Cloning Information : 653922
HIP Master Clone ID : 178204
Original Clone ID : HsCD00301064
Original Clone ID : FLH230724.01L
Original Clone ID : HsCD00298813
Original Clone ID : HsCD00616943
Original Clone ID : FLH231558.01L

Organism


TAX_ID : 9606
Species Specific ID: 9414

Genome

Chromosome : 9
Map Location : 9q13-q21
Ensembl : ENSG00000119139

Reagents

Labome : TJP2-antibody