DNASU Plasmid Repository • 480.965.5697 | Email

IRAK3 (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IRAK3
Gene Name:  interleukin-1 receptor-associated kinase 3
Sequence             
Original Clone ID: FLH230271.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00617972

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1791nts         Open reading frame : 78 to 1868

GCGGTTGTGTAACGGCCTGTCGCAGGCGTGCAGGGACCTGGACTCCGCCTCGTCCCCGGG
GCTCGGGCAGCCGAGCCATGGCGGGGAACTGTGGGGCCCGCGGCGCGCTGTCGGCGCACA
CGCTGCTGTTCGACCTGCCGCCCGCGCTGCTCGGAGAGCTCTGCGCTGTTCTGGACAGCT
GCGACGGCGCGCTGGGCTGGCGCGGCCTGGCAGAGAGACTTTCAAGCAGCTGGCTGGATG
TTCGTCATATTGAAAAGTATGTAGACCAAGGTAAAAGTGGAACAAGAGAATTACTTTGGT
CCTGGGCACAGAAAAACAAGACCATCGGTGACCTTTTACAGGTCCTCCAGGAGATGGGAC
ATCGTCGAGCTATTCATTTAATTACAAACTATGGAGCAGTGTTGAGTCCTTCAGAGAAGA
GTTATCAGGAAGGTGGATTTCCAAATATATTATTCAAGGAAACAGCCAATGTCACCGTGG
ATAATGTTCTTATTCCTGAACATAATGAAAAAGGAGTACTGCTTAAATCTTCCATCAGCT
TTCAAAATATCATAGAAGGAACTAGAAATTTCCACAAAGACTTCCTAATTGGAGAAGGAG
AGATTTTTGAGGTATACAGAGTGGAGATTCAAAACCTAACATATGCTGTCAAATTATTTA
AACAGGAGAAAAAAATGCAGTGTAAGAAGCATTGGAAGAGGTTTTTATCTGAGCTTGAAG
TTTTACTACTGTTTCATCACCCAAACATACTAGAGTTGGCTGCATATTTTACAGAGACTG
AGAAGTTCTGTCTGATTTATCCATACATGAGAAATGGAACACTTTTTGACAGATTGCAGT
GTGTAGGTGACACGGCCCCACTCCCTTGGCACATTCGAATCGGTATATTAATAGGAATAT
CCAAAGCCATTCACTACCTGCACAACGTTCAACCATGCTCGGTCATCTGTGGCAGTATAT
CAAGTGCAAACATCCTTTTGGATGATCAGTTTCAACCCAAACTAACTGATTTTGCCATGG
CACACTTCCGGTCCCACCTAGAACATCAGAGTTGTACCATAAATATGACCAGCAGCAGCA
GTAAACATCTGTGGTACATGCCAGAAGAGTACATCAGACAGGGGAAACTTTCCATTAAAA
CAGATGTCTACAGCTTTGGAATTGTAATAATGGAAGTTCTAACAGGATGTAGAGTAGTGT
TAGATGATCCAAAACATATCCAGCTGCGGGATCTCCTTAGAGAATTGATGGAGAAGAGAG
GCCTGGATTCATGTCTCTCATTTCTAGATAAGAAAGTGCCTCCCTGCCCTCGGAATTTCT
CTGCCAAGCTCTTCTGTTTGGCAGGCCGGTGTGCTGCAACGCGGGCAAAGTTAAGACCAT
CAATGGATGAAGTTTTAAATACTCTTGAAAGTACTCAAGCCAGCTTGTATTTTGCTGAAG
ATCCTCCCACATCACTAAAGTCCTTCAGGTGTCCTTCTCCTCTATTCCTGGAGAATGTAC
CAAGTATTCCAGTGGAAGATGATGAAAGCCAGAATAACAATTTACTACCTTCTGATGAAG
GCCTGAGGATAGACAGAATGACTCAGAAAACTCCTTTTGAATGCAGCCAGTCTGAGGTTA
TGTTTCTGAGCTTGGACAAAAAGCCAGAGAGCAAGAGAAATGAGGAAGCTTGCAACATGC
CCAGTTCTTCTTGTGAAGAAAGTTGGTTCCCAAAGTATATAGTTCCATCCCAGGACTTAA
GGCCCTATAAGGTAAATATAGATCCTTCTTCAGAAGCTCCAGGGCATTCTTGCAGGAGCA
GGCCAGTGGAGAGCAGCTGTTCCTCCAAATTTTCCTGGGATGAATATGAACAGTACAAAA
AAGAATAAATTCTACCAGAAGATAAAGAAAAAAGCAAGTATTGCATAGGCACCTGAGCAT
AGGTATGACCTTGGGAAGACATTGGCTCCATAAGCAATGCCAAGAGAATGATCAATAGTG
AGTTTGGGTGATGCAGATAAACAATCTGGATAATTCCATTTCTTTTTCCCAAACCCTCAA
ACAGAGTGCCTTAAAAAATTGTTTTATCAGGATAATTGTCTCATGACCAAATCCACGCTC
AATTAGAGCCATTCAAAATTCCTTAAGATCATGGGTTCTGACTTCAGCCAAACAAAACAA
TCAAAACCTACCAAAAAGGGACTGGATTGTAATGTCCTCTCCATCATCCTCAGTGTGAGT
CCTCAGAGCCTCCATCTGCCAAGAACATTCAGTTGGATTCCATCGTTTGGTTTAGCTTGC
TTGCACGGGTTGTAGGAAATGTCTAATTTGTAAATGTTAATAGATACCTTTGGAAAGAAA
AAAAAAAAAAAAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IRAK3
Symbol Nomenclature : IRAK3
SYNONYM : ASRT5; IRAKM
Designation : IL-1 receptor-associated kinase M
Full Nomenclature : interleukin-1 receptor-associated kinase 3
GENEID : 11213
HGNC : 17020
MIM : 604459
Vega : OTTHUMG00000169002
Target GenBank: BC057800

 

Pathways

NCI : IL1-mediated signaling events
Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Cytokine Signaling in Immune system
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Signaling by Interleukins
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : Regulation of toll-like receptor signaling pathway

Clone

Cloning Information : 653948
HIP Master Clone ID : 178199
Original Clone ID : HsCD00298416
Original Clone ID : FLH230750.01L
Original Clone ID : HsCD00298618
Original Clone ID : FLH230271.01L

Organism


TAX_ID : 9606
Species Specific ID: 11213

Genome

Chromosome : 12
Map Location : 12q14.3
Ensembl : ENSG00000090376

Reagents

Labome : IRAK-M-antibody