DNASU Plasmid Repository • 480.965.5697 | Email

AURKC (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AURKC
Gene Name:  aurora kinase C
Sequence             
Original Clone ID: HsCD00299090
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00617979

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 828nts         Open reading frame : 352 to 1179

CACAACGGCCATCACCACCTCTCCGCACCCTCTGTCTCCTTCCTTCTCGGGCCTCACCCC
TGGCCCTCGCTTTCAGTGCCCAGCCCGGACCGCAGCACTCCAGTTCCGCCCCAACCCGGG
AACCCTGGACTGAGGCTCCCGTTTCTGTCCTTTCTATTGGGCGCACTTCCGATGGCGTCA
GGAATTTCAGCCAATAGGAGCCAGCCAGGAAGTACCTCTCTGAGCGGTTGGTGCCGGGTA
TAAAAGAAGGCCAGCACGGCTGCTCACGACGCCGCGAAGCCTGTGTAGCACTGAGACATC
AGTGAGTTGGCTACAGCAGACCAAACAGCCCAGCAGCCCAGCAGCCCACGCATGCGGCGC
CTCACAGTCGATGACTTTGAAATCGGGCGTCCCCTGGGCAAGGGGAAATTTGGGAATGTG
TACCTGGCTCGGCTCAAGGAAAGCCATTTCATTGTGGCCCTGAAGGTTCTCTTCAAGTCG
CAGATAGAGAAGGAAGGACTGGAGCACCAGCTGCGCCGGGAAATTGAGATCCAGGCTCAT
CTACAACACCCCAATATCCTGCGCCTGTATAACTATTTCCATGATGCACGCCGGGTGTAC
CTGATTCTGGAATATGCTCCAAGGGGTGAGCTCTACAAGGAGCTGCAGAAAAGCGAGAAA
TTAGATGAACAGCGCACAGCCACGATAATAGAGGAAGTTGCAGATGCCCTGACCTACTGC
CATGACAAGAAAGTGATTCACAGAGATATTAAGCCAGAGAACCTGCTGCTGGGGTTCAGG
GGTGAGGTGAAGATTGCAGATTTTGGCTGGTCTGTGCACACCCCCCTCCCTGAGAGGAAG
ACAATGTGTGGGACACTGGACTACTTGCCGCCAGAAATGATTGAGGGGAGAACATATGAT
GAAAAGGTGGATTTGTGGTGCATTGGAGTGCTCTGCTATGAGCTGCTGGTGGGATATCCA
CCCTTTGAGAGCGCCTCCCACAGTGAGACTTACAGACGCATCCTCAAGGTAGATGTGAGG
TTTCCACTATCAATGCCTCTGGGGGCCCGGGACTTGATTTCCAGGCTTCTCAGATACCAG
CCCTTGGAGAGACTGCCCCTGGCCCAGATCCTGAAGCACCCCTGGGTTCAGGCCCACTCC
CGAAGGGTGCTGCCTCCCTGTGCTCAGATGGCTTCCTGAGCCCTGTCTGCCTCTGTTCCC
TTTGTGTGTGTTCAGGGAGCTCTCCTGCTCTGCCACCTCATTTGTCTTTATTTTTTTCTC
TTTTAAGATGTAAGATGCTAATTAATAAAAGCTGAATCATTTCATACCAAAAAAAAAAAA
AAAAAAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : AURKC
Symbol Nomenclature : AURKC
SYNONYM : AIE2; AIK3; ARK3; AurC; SPGF5; STK13; aurora-C
Designation : ARK-3|aurora 3|aurora-related kinase 3|aurora/IPL1-related kinase 3|aurora/IPL1/EG2 protein 2|serine/threonine kinase 13 (aurora/IPL1-like)|serine/threonine-protein kinase 13|serine/threonine-protein kinase aurora-C
Full Nomenclature : aurora kinase C
GENEID : 6795
HGNC : 11391
MIM : 603495
Vega : OTTHUMG00000183106
Target GenBank: NM_003160

 

Pathways

NCI : Aurora B signaling
NCI : Aurora C signaling
NCI : Signaling by Aurora kinases

Clone

Cloning Information : 653662
HIP Master Clone ID : 148798
Original Clone ID : FLH231795.01L
Original Clone ID : HsCD00301056
Original Clone ID : FLH231794.01L
Original Clone ID : HsCD00299090

Organism


TAX_ID : 9606
Species Specific ID: 6795

Genome

Chromosome : 19
Map Location : 19q13.43
Ensembl : ENSG00000105146

Reagents

Labome : AURKC-antibody