DNASU Plasmid Repository • 480.965.5697 | Email

GUK1 (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GUK1
Gene Name:  guanylate kinase 1
Sequence             
Original Clone ID: HsCD00299594
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00618007

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 594nts         Open reading frame : 225 to 818

GGCACGAGGCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGGCCCCACCGGACGGCT
TGCTCTGCTCTTTACCTGGGGTTGCTGTCGAGGACCCTGTGCAAGACTCGGCCGGTTTTT
CTTTCTCCCTGATGGACAGACCCAAACATAGCCGCGCAGCATCGTGAAGGGCTGGGGCCT
TCACTCCTCTGTGGCTCTGGAAGAGCCCGATTTCCTCAGGAGGCATGTCGGGCCCCAGGC
CTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACCCTGCTGAAGAGGCTGCTCC
AGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACCACGAGGAACCCGAGGCCCG
GCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAGGTGATGCAGCGTGACATAG
CAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAACCTGTATGGCACGAGCAAGG
TGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTGCTGGACGTGGACCTGCAGG
GTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTACATCTCTGTGCAGCCGCCTT
CACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACTGAAACCGAGGAGAGCCTGG
TGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGCAAGGAGCCCGGCCTGTTTG
ATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCAGAGCTGAAGGAGGCGCTCT
CTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTGAGGCTTGCTGTCTGTTCTCGGCA
CCCCGGGCCCATACAGGACCAGGGCAGCAGCATTGAGCCACCCCCTTGGCAGGCGATACG
GCAGCTCTGTGCCCTTGGCCAGCATGTGGAGTGGAGGAGATGCTGCCCCTGTGGTTGGAA
CATCCTGGGGTGACCCCCGACCCAGCCTCGCTGGGCTGTCCCCTGTCCCTATCTCTCACT
CTGGACCCAGGGCTGACATCCTAATAAAATAACTGTTGGATTAGAAAAAAAAAAAAAAAA
AA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GUK1
Symbol Nomenclature : GUK1
SYNONYM : GMK
Designation : ATP:GMP phosphotransferase|GMP kinase|guanylate kinase
Full Nomenclature : guanylate kinase 1
GENEID : 2987
Locus Tag : RP11-520H14.2
HGNC : 4693
MIM : 139270
Vega : OTTHUMG00000039503
Target GenBank: BC009914

 

Pathways

Panther : De novo purine biosynthesis
Reactome : Abacavir metabolism
Reactome : Abacavir transport and metabolism
Reactome : Metabolism
Reactome : Metabolism of nucleotides
Reactome : Synthesis and interconversion of nucleotide di- and triphosphates

Protein

SMART domain : GuKc : Guanylate kinase homologues.
UniProt : Q6IBG8
UniProt : Q16774
HPRD : 00755

Clone

Cloning Information : 654744
HIP Master Clone ID : 87187
IMAGE ID : 2821563
Original Clone ID : FLH231939.01L
Original Clone ID : HsCD00299594

Organism


TAX_ID : 9606
Species Specific ID: 2987

Genome

Chromosome : 1
Map Location : 1q32-q41
Ensembl : ENSG00000143774

Reagents

Labome : GUK1-antibody