DNASU Plasmid Repository • 480.965.5697 | Email

MAP2K1 (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAP2K1
Gene Name:  mitogen-activated protein kinase kinase 1
Sequence             
Original Clone ID: HsCD00298641
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00618033

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1182nts         Open reading frame : 73 to 1254

ATTCGGCACGAGGGAGGAAGCGAGAGGTGCTGCCCTCCCCCCGGAGTTGGAAGCGCGTTA
CCCGGGTCCAAAATGCCCAAGAAGAAGCCGACGCCCATCCAGCTGAACCCGGCCCCCGAC
GGCTCTGCAGTTAACGGGACCAGCTCTGCGGAGACCAACTTGGAGGCCTTGCAGAAGAAG
CTGGAGGAGCTAGAGCTTGATGAGCAGCAGCGAAAGCGCCTTGAGGCCTTTCTTACCCAG
AAGCAGAAGGTGGGAGAACTGAAGGATGACGACTTTGAGAAGATCAGTGAGCTGGGGGCT
GGCAATGGCGGTGTGGTGTTCAAGGTCTCCCACAAGCCTTCTGGCCTGGTCATGGCCAGA
AAGCTAATTCATCTGGAGATCAAACCCGCAATCCGGAACCAGATCATAAGGGAGCTGCAG
GTTCTGCATGAGTGCAACTCTCCGTACATCGTGGGCTTCTATGGTGCGTTCTACAGCGAT
GGCGAGATCAGTATCTGCATGGAGCACATGGATGGAGGTTCTCTGGATCAAGTCCTGAAG
AAAGCTGGAAGAATTCCTGAACAAATTTTAGGAAAAGTTAGCATTGCTGTAATAAAAGGC
CTGACATATCTGAGGGAGAAGCACAAGATCATGCACAGAGATGTCAAGCCCTCCAACATC
CTAGTCAACTCCCGTGGGGAGATCAAGCTCTGTGACTTTGGGGTCAGCGGGCAGCTCATC
GACTCCATGGCCAACTCCTTCGTGGGCACAAGGTCCTACATGTCGCCAGAAAGACTCCAG
GGGACTCATTACTCTGTGCAGTCAGACATCTGGAGCATGGGACTGTCTCTGGTAGAGATG
GCGGTTGGGAGGTATCCCATCCCTCCTCCAGATGCCAAGGAGCTGGAGCTGATGTTTGGG
TGCCAGGTGGAAGGAGATGCGGCTGAGACCCCACCCAGGCCAAGGACCCCCGGGAGGCCC
CTTAGCTCATACGGAATGGACAGCCGACCTCCCATGGCAATTTTTGAGTTGTTGGATTAC
ATAGTCAACGAGCCTCCTCCAAAACTGCCCAGTGGAGTGTTCAGTCTGGAATTTCAAGAT
TTTGTGAATAAATGCTTAATAAAAAACCCCGCAGAGAGAGCAGATTTGAAGCAACTCATG
GTTCATGCTTTTATCAAGAGATCTGATGCTGAGGAAGTGGATTTTGCAGGTTGGCTCTGC
TCCACCATCGGCCTTAACCAGCCCAGCACACCAACCCATGCTGCTGGCGTCTAAGTGTTT
GGGAAGCAACAAAGAGCGAGTCCCCTGCCCGGTGGTTTGCCATGTCGCTTTTGGGCCTCC
TTCCCATGCCTGTCTCTGTTCAGATGTGCATTTCACCTGTGACAAAGGATGAAGAACACA
GCATGTGCCAAGATTCTACTCTTGTCATTTTTAATATTACTGTCTTTATTCTTATTACTA
TTATTGTTCCCCTAAGTGGATTGGCTTTGTGCTTGGGGCTATTTGTGTGTATGCTGATGA
TCAAAACCTGTGCCAGGCTGAATTACAGTGAAATTTTTGGTGAATGTGGGTAGTCATTCT
TACAATTGCACTGCTGTTCCTGCTCCATGACTGGCTGTCTGCCTGTATTTTCGGACTTTG
ACATTTGACATTTGGTGGACTTTATCTTGCTGGGCATACTTTCTCTCTAGGAGGGAGCCT
TGTGAGATCCTTCACAGGCAGTGCATGTGAAGCATGCTTTGCTGCTATGAAAATGAGCAT
CAGAGAGTGTACATCATGTTATTTTATTATTATTATTTGCTTTTCATGTAGAACTCAGCA
GTTGACATCCAAATCTAGCCAGAGCCCTTCACTGCCATGATAGCTGGGGCTTCACCAGTC
TGTCTACTGTGGTGATCTGTAGACTTCTGGTTGTATTTCTATATTTATTTTCAGTATACT
GTGTGGGATACTTAGTGGTATGTCTCTTTAAGTTTTGATTAATGTTTCTTAAATGGAATT
ATTTGAATGTCACAAATTGATCAAGATATTAAAATGTCGGATTTATCTTTCCCCATATCC
AAGTACCAATGCTGTTGTAAACAACGTGTATAGTGCCTAAAATTGTATGAAAATCCTTTT
AACCATTTTAACCTAGATGTTTAACAAATCTAATCTCTTATTCTAATAAATATACTATGA
AATAAAAAAAAAAGGAGAAAGCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAP2K1
Symbol Nomenclature : MAP2K1
SYNONYM : CFC3; MAPKK1; MEK1; MKK1; PRKMK1
Designation : ERK activator kinase 1|MAPK/ERK kinase 1|MAPKK 1|MEK 1|dual specificity mitogen-activated protein kinase kinase 1|protein kinase, mitogen-activated, kinase 1 (MAP kinase kinase 1)
Full Nomenclature : mitogen-activated protein kinase kinase 1
GENEID : 5604
HGNC : 6840
MIM : 176872
Target GenBank: NM_002755

 

Pathways

NCI : BCR signaling pathway
NCI : CXCR3-mediated signaling events
NCI : Cellular roles of Anthrax toxin
NCI : Ceramide signaling pathway
NCI : Class IB PI3K non-lipid kinase events
NCI : Downstream signaling in naïve CD8+ T cells
NCI : EPHB forward signaling
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : FOXM1 transcription factor network
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : IFN-gamma pathway
NCI : IL2-mediated signaling events
NCI : Netrin-mediated signaling events
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Nongenotropic Androgen signaling
NCI : PDGFR-beta signaling pathway
NCI : Ras signaling in the CD4+ TCR pathway
NCI : SHP2 signaling
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by focal adhesion kinase
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : mTOR signaling pathway
Panther : Angiogenesis
Panther : Angiotensin II-stimulated signaling through G proteins and beta-arrestin
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Integrin signalling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : Toll receptor signaling pathway
Panther : VEGF signaling pathway
Reactome : ARMS-mediated activation
Reactome : Activated TLR4 signalling
Reactome : Axon guidance
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : ERK activation
Reactome : ERK1 activation
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Frs2-mediated activation
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin-1 signaling
Reactome : Interleukin-2 signaling
Reactome : L1CAM interactions
Reactome : MAP kinase activation in TLR cascade
Reactome : MEK activation
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Prolonged ERK activation events
Reactome : RAF phosphorylates MEK
Reactome : RAF/MAP kinase cascade
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Signal Transduction
Reactome : Signal transduction by L1
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Signalling to p38 via RIT and RIN
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : EPO Receptor Signaling
WikiPathway : ErbB signaling pathway
WikiPathway : Estrogen signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : Hypothetical Network for Drug Addiction
WikiPathway : IL-1 signaling pathway
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : IL-9 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Nifedipine Activity
WikiPathway : Osteopontin Signaling
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Senescence and Autophagy
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : Serotonin Receptor 2 and ELK-SRF/GATA4 signaling
WikiPathway : Serotonin Receptor 4/6/7 and NR3C Signaling
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : angiogenesis overview

Clone

Cloning Information : 654806
HIP Master Clone ID : 36910
Original Clone ID : FLH230776.01L
Original Clone ID : HsCD00298641

Organism


TAX_ID : 9606
Species Specific ID: 5604

Genome

Chromosome : 15
Map Location : 15q22.1-q22.33

Reagents

Labome : MEK1-antibody