DNASU Plasmid Repository • 480.965.5697 | Email

TPK1 (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TPK1
Gene Name:  thiamin pyrophosphokinase 1
Sequence             
Original Clone ID: HsCD00299625
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00618093

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 414nts         Open reading frame : 229 to 642

TATTTTCGTCATCTTTGGAACAAAGCTCTTTTAAGAGCCTGTGCCGATGGAGGTGCCAAC
CGCTTATATGATATCACCGAAGGAGAGAGAGAAAGCTTTTTGCCTGAATTCATCAATGGA
GACTTTGATTCTATTAGGCCTGAAGTCAGAGAATACTATGCTACTAAGGGATGTGAGCTC
ATTTCAACTCCTGATCAAGACCACACTGACTTTACTAAGTGCCTTAAAATGCTCCAAAAG
AAGATAGAAGAAAAAGACTTAAAGGTTGATGTGATCGTGACACTGGGAGGCCTTGCTGGG
CGTTTTGACCAGATTATGGCATCTGTGAATACCTTGTTCCAAGCGACTCACATCACTCCT
TTTCCAATTATAATAATCCAAGAGGAATCGCTGATCTACCTGCTCCAACCAGGAAAGCAC
AGGTTGCATGTAGACACTGGAATGGAGGGTGATTGGTGTGGCCTTATTCCTGTTGGACAG
CCTTGTATGCAGGTTACAACCACAGGCCTCAAGTGGAACCTCACAAATGATGTGCTTGCT
TTTGGAACATTGGTCAGTACTTCCAATACCTACGACGGGTCTGGTGTTGTGACTGTGGAA
ACTGACCACCCACTCCTCTGGACCATGGCCATCAAAAGCTAACCTGTTGACTGGCATCCA
TAAGTGTGCCTCTGCCTTATCTCATTTCTCAACAGTTCATTGCTCAACAAGAACGATTCA
CCTGGGTTTGCAAGAATCTAAACCTCTCTAGGGGAAGCCCACTGGGTTTAAAGATGTTAG
TGTTTAGATAATACAGGTAACATTATAAATGACAGATCTCAATTTTATAGTAGTGGGAAA
GATACATGCTAAGAAAGCAAATAAGCTCTATTAAATGTATTCACCTTTCTTTTGTAAAGA
GACCATCTTCTATCTTCTTTCCACCTTTCTCTGTTTTATGAAACCAACTGTTGACATACA
AACCATGATTGAAGGAGAACCTGTCCAACATGTTTTATGTACACAAATCCCTATGTTGCT
ATAAGAAAAGTGAAAGTAACTGTTTTCTTCTTGGTGCTATGACAGTGTGAGACTCAGGTT
GTCTGTAGAGAATGAAAGGAGCAGTGGCCCGCGTGATTGTGGCATTTAAGGAGCAGTGGC
CCATGTGACTGTGGCATTTTCGGCACTTTTCATTACTTTCTGCTTGACCGGAAGTTGAGG
CTTAGCTATGTTTCCATCTTCAGTTTCTGAAGACTAGTTATATATTCCTTACTAGAAATA
TATTCATAATATATAAAAGAAATATATCTGTGATTTTAAAATTTTGCTACCAAAGAATGC
ATGTTCTGTGTGCCCTGAAAATGTTACCAGTGTTAATAAATGGATACTTATCAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TPK1
Symbol Nomenclature : TPK1
SYNONYM : HTPK1; PP20; THMD5
Designation : placental protein 20|thiamine diphosphokinase|thiamine kinase
Full Nomenclature : thiamin pyrophosphokinase 1
GENEID : 27010
HGNC : 17358
MIM : 606370
Vega : OTTHUMG00000152774
Target GenBank: NM_022445

 

Pathways

Panther : Thiamin metabolism
Reactome : Defective AMN causes hereditary megaloblastic anemia 1
Reactome : Defective BTD causes biotidinase deficiency
Reactome : Defective CD320 causes methylmalonic aciduria
Reactome : Defective CUBN causes hereditary megaloblastic anemia 1
Reactome : Defective GIF causes intrinsic factor deficiency
Reactome : Defective HLCS causes multiple carboxylase deficiency
Reactome : Defective LMBRD1 causes methylmalonic aciduria and homocystinuria type cblF
Reactome : Defective MMAA causes methylmalonic aciduria type cblA
Reactome : Defective MMAB causes methylmalonic aciduria type cblB
Reactome : Defective MMACHC causes methylmalonic aciduria and homocystinuria type cblC
Reactome : Defective MMADHC causes methylmalonic aciduria and homocystinuria type cblD
Reactome : Defective MTR causes methylmalonic aciduria and homocystinuria type cblG
Reactome : Defective MTRR causes methylmalonic aciduria and homocystinuria type cblE
Reactome : Defective MUT causes methylmalonic aciduria mut type
Reactome : Defective TCN2 causes hereditary megaloblastic anemia
Reactome : Defects in biotin (Btn) metabolism
Reactome : Defects in cobalamin (B12) metabolism
Reactome : Defects in vitamin and cofactor metabolism
Reactome : Disease
Reactome : Metabolism
Reactome : Metabolism of vitamins and cofactors
Reactome : Metabolism of water-soluble vitamins and cofactors
Reactome : Vitamin B1 (thiamin) metabolism

Clone

Cloning Information : 649684
HIP Master Clone ID : 87226
Original Clone ID : FLH231972.01L
Original Clone ID : HsCD00299233
Original Clone ID : FLH232238.01L
Original Clone ID : HsCD00299625

Organism


TAX_ID : 9606
Species Specific ID: 27010

Genome

Chromosome : 7
Map Location : 7q34-q35
Ensembl : ENSG00000196511

Reagents

Labome : TPK1-antibody