DNASU Plasmid Repository • 480.965.5697 | Email

RPA3 (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RPA3
Gene Name:  replication protein A3, 14kDa
Sequence             
Original Clone ID: FLH232535.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00618172

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 366nts         Open reading frame : 46 to 411

AGTCGTCCGTGGGTTTCCCGCCAGCCGCAGTCTTGGACCATAATCATGGTGGACATGATG
GACTTGCCCAGGTCGCGCATCAACGCCGGCATGCTAGCTCAATTCATCGACAAGCCTGTC
TGCTTCGTAGGGAGGCTGGAAAAGATTCATCCCACCGGAAAAATGTTTATTCTTTCAGAT
GGAGAAGGAAAAAATGGAACCATCGAGTTGATGGAACCCCTTGATGAAGAAATCTCTGGA
ATTGTGGAAGTGGTTGGAAGAGTAACCGCCAAGGCCACCATCTTGTGTACATCTTATGTC
CAGTTTAAAGAAGATAGCCATCCTTTTGATCTTGGACTTTACAATGAAGCTGTGAAAATT
ATCCATGACTTCCCTCAGTTTTATCCTTTAGGGATTGTGCAACATGATTGATCTTGATGG
ATTTTCATACGATTGTAAATGAGCTATATTAAAGTCTATTAAAGGAAGCCCTTCTTGTTT
GAGGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome

Gene

 

Gene Symbol : RPA3
Symbol Nomenclature : RPA3
SYNONYM : REPA3
Designation : RF-A protein 3|RP-A p14|replication factor A protein 3|replication protein A 14 kDa subunit
Full Nomenclature : replication protein A3, 14kDa
GENEID : 6119
HGNC : 10291
MIM : 179837
Target GenBank: BC005264

 

Pathways

Panther : Cell cycle
Reactome : Activation of ATR in response to replication stress
Reactome : Activation of the pre-replicative complex
Reactome : Assembly of the RAD51-ssDNA nucleoprotein complex
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : DNA strand elongation
Reactome : Double-Strand Break Repair
Reactome : Dual incision reaction in GG-NER
Reactome : Extension of Telomeres
Reactome : Formation of incision complex in GG-NER
Reactome : G1/S Transition
Reactome : G2/M Checkpoints
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : HSF1 activation
Reactome : Homologous DNA pairing and strand exchange
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Lagging Strand Synthesis
Reactome : M/G1 Transition
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Nucleotide Excision Repair
Reactome : Presynaptic phase of homologous DNA pairing and strand exchange
Reactome : Processing of DNA double-strand break ends
Reactome : Processive synthesis on the C-strand of the telomere
Reactome : Processive synthesis on the lagging strand
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Removal of the Flap Intermediate
Reactome : Removal of the Flap Intermediate from the C-strand
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)
WikiPathway : DNA Replication
WikiPathway : G1 to S cell cycle control

Protein

HPRD : 01567

Clone

Cloning Information : 654621
HIP Master Clone ID : 55481
IMAGE ID : 3826762
Original Clone ID : HsCD00299021
Original Clone ID : FLH232535.01X

Organism


TAX_ID : 9606
Species Specific ID: 6119

Genome

Chromosome : 7
Map Location : 7p22