DNASU Plasmid Repository • 480.965.5697 | Email

ADH1A (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ADH1A
Gene Name:  alcohol dehydrogenase 1A (class I), alpha polypeptide
Sequence             
Original Clone ID: ccsbBroadEn_00027
Keyword: PERFECT_MATCH
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00622803

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1128nts         Open reading frame : 1 to 1128
Reference Sequence Alignment

ATGAGCACAGCAGGAAAAGTAATCAAATGCAAAGCAGCTGTGCTATGGGAGTTAAAGAAA
CCCTTTTCCATTGAGGAGGTGGAGGTTGCACCTCCTAAGGCCCATGAAGTTCGTATTAAG
ATGGTGGCTGTAGGAATCTGTGGCACAGATGACCACGTGGTTAGTGGTACCATGGTGACC
CCACTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAGTGTTGGAGAAGGG
GTGACTACAGTCAAACCAGGTGATAAAGTCATCCCACTCGCTATTCCTCAGTGTGGAAAA
TGCAGAATTTGTAAAAACCCGGAGAGCAACTACTGCTTGAAAAACGATGTAAGCAATCCT
CAGGGGACCCTGCAGGATGGCACCAGCAGGTTCACCTGCAGGAGGAAGCCCATCCACCAC
TTCCTTGGCATCAGCACCTTCTCACAGTACACAGTGGTGGATGAAAATGCAGTAGCCAAA
ATTGATGCAGCCTCGCCTCTAGAGAAAGTCTGTCTCATTGGCTGTGGATTTTCAACTGGT
TATGGGTCTGCAGTCAATGTTGCCAAGGTCACCCCAGGCTCTACCTGTGCTGTGTTTGGC
CTGGGAGGGGTCGGCCTATCTGCTATTATGGGCTGTAAAGCAGCTGGGGCAGCCAGAATC
ATTGCGGTGGACATCAACAAGGACAAATTTGCAAAGGCCAAAGAGTTGGGTGCCACTGAA
TGCATCAACCCTCAAGACTACAAGAAACCCATCCAGGAGGTGCTAAAGGAAATGACTGAT
GGAGGTGTGGATTTTTCATTTGAAGTCATCGGTCGGCTTGACACCATGATGGCTTCCCTG
TTATGTTGTCATGAGGCATGTGGCACAAGTGTCATCGTAGGGGTACCTCCTGATTCCCAA
AACCTCTCAATGAACCCTATGCTGCTACTGACTGGACGTACCTGGAAGGGAGCTATTCTT
GGTGGCTTTAAAAGTAAAGAATGTGTCCCAAAACTTGTGGCTGATTTTATGGCTAAGAAG
TTTTCATTGGATGCATTAATAACCCATGTTTTACCTTTTGAAAAAATAAATGAAGGATTT
GACCTGCTTCACTCTGGGAAAAGTATCCGTACCATTCTGATGTTTTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome

Gene

 

Gene Symbol : ADH1A
Symbol Nomenclature : ADH1A
SYNONYM : ADH1
Designation : ADH, alpha subunit|alcohol dehydrogenase 1 (class I), alpha polypeptide|alcohol dehydrogenase 1A|alcohol dehydrogenase subunit alpha|aldehyde reductase
Full Nomenclature : alcohol dehydrogenase 1A (class I), alpha polypeptide
GENEID : 124
HGNC : 249
MIM : 103700
Vega : OTTHUMG00000131026
Target GenBank: BC126306.1

 

Reference Sequence Alignment

  

HsCD00622803      ATGAGCACAGCAGGAAAAGTAATCAAATGCAAAGCAGCTGTGCTATGGGAGTTAAAGAAA
NM_000668.5       ATGAGCACAGCAGGAAAAGTAATCAAATGCAAAGCAGCTGTGCTATGGGAGGTAAAGAAA
NM_000667.3       ATGAGCACAGCAGGAAAAGTAATCAAATGCAAAGCAGCTGTGCTATGGGAGTTAAAGAAA
                  *************************************************** ********

HsCD00622803      CCCTTTTCCATTGAGGAGGTGGAGGTTGCACCTCCTAAGGCCCATGAAGTTCGTATTAAG
NM_000668.5       CCCTTTTCCATTGAGGATGTGGAGGTTGCACCTCCTAAGGCTTATGAAGTTCGCATTAAG
NM_000667.3       CCCTTTTCCATTGAGGAGGTGGAGGTTGCACCTCCTAAGGCCCATGAAGTTCGTATTAAG
                  ***************** ***********************  ********** ******

HsCD00622803      ATGGTGGCTGTAGGAATCTGTGGCACAGATGACCACGTGGTTAGTGGTACCATGGTGACC
NM_000668.5       ATGGTGGCTGTAGGAATCTGTCACACAGATGACCACGTGGTTAGTGGCAACCTGGTGACC
NM_000667.3       ATGGTGGCTGTAGGAATCTGTGGCACAGATGACCACGTGGTTAGTGGTACCATGGTGACC
                  ********************* .************************ *.*.********

HsCD00622803      CCACTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAGTGTTGGAGAAGGG
NM_000668.5       CCCCTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAGTGTTGGAGAAGGG
NM_000667.3       CCACTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAGTGTTGGAGAAGGG
                  **.*********************************************************

HsCD00622803      GTGACTACAGTCAAACCAGGTGATAAAGTCATCCCACTCGCTATTCCTCAGTGTGGAAAA
NM_000668.5       GTGACTACAGTCAAACCAGGTGATAAAGTCATCCCGCTCTTTACTCCTCAGTGTGGAAAA
NM_000667.3       GTGACTACAGTCAAACCAGGTGATAAAGTCATCCCACTCGCTATTCCTCAGTGTGGAAAA
                  ***********************************.***  ** ****************

HsCD00622803      TGCAGAATTTGTAAAAACCCGGAGAGCAACTACTGCTTGAAAAACGATGTAAGCAATCCT
NM_000668.5       TGCAGAGTTTGTAAAAACCCGGAGAGCAACTACTGCTTGAAAAATGATCTAGGCAATCCT
NM_000667.3       TGCAGAATTTGTAAAAACCCGGAGAGCAACTACTGCTTGAAAAACGATGTAAGCAATCCT
                  ******.************************************* *** **.********

HsCD00622803      CAGGGGACCCTGCAGGATGGCACCAGCAGGTTCACCTGCAGGAGGAAGCCCATCCACCAC
NM_000668.5       CGGGGGACCCTGCAGGATGGCACCAGGAGGTTCACCTGCAGGGGGAAGCCCATTCACCAC
NM_000667.3       CAGGGGACCCTGCAGGATGGCACCAGCAGGTTCACCTGCAGGAGGAAGCCCATCCACCAC
                  *.************************ ***************.********** ******

HsCD00622803      TTCCTTGGCATCAGCACCTTCTCACAGTACACAGTGGTGGATGAAAATGCAGTAGCCAAA
NM_000668.5       TTCCTTGGCACCAGCACCTTCTCCCAGTACACGGTGGTGGATGAGAATGCAGTGGCCAAA
NM_000667.3       TTCCTTGGCATCAGCACCTTCTCACAGTACACAGTGGTGGATGAAAATGCAGTAGCCAAA
                  ********** ************.********.***********.********.******

HsCD00622803      ATTGATGCAGCCTCGCCTCTAGAGAAAGTCTGTCTCATTGGCTGTGGATTTTCAACTGGT
NM_000668.5       ATTGATGCAGCCTCGCCCCTGGAGAAAGTCTGCCTCATTGGCTGTGGATTCTCGACTGGT
NM_000667.3       ATTGATGCAGCCTCGCCTCTAGAGAAAGTCTGTCTCATTGGCTGTGGATTTTCAACTGGT
                  ***************** **.*********** ***************** **.******

HsCD00622803      TATGGGTCTGCAGTCAATGTTGCCAAGGTCACCCCAGGCTCTACCTGTGCTGTGTTTGGC
NM_000668.5       TATGGGTCTGCAGTTAACGTTGCCAAGGTCACCCCAGGCTCTACCTGTGCTGTGTTTGGC
NM_000667.3       TATGGGTCTGCAGTCAATGTTGCCAAGGTCACCCCAGGCTCTACCTGTGCTGTGTTTGGC
                  ************** ** ******************************************

HsCD00622803      CTGGGAGGGGTCGGCCTATCTGCTATTATGGGCTGTAAAGCAGCTGGGGCAGCCAGAATC
NM_000668.5       CTGGGAGGGGTCGGCCTATCTGCTGTTATGGGCTGTAAAGCAGCTGGAGCAGCCAGAATC
NM_000667.3       CTGGGAGGGGTCGGCCTATCTGCTATTATGGGCTGTAAAGCAGCTGGGGCAGCCAGAATC
                  ************************.**********************.************

HsCD00622803      ATTGCGGTGGACATCAACAAGGACAAATTTGCAAAGGCCAAAGAGTTGGGTGCCACTGAA
NM_000668.5       ATTGCGGTGGACATCAACAAGGACAAATTTGCAAAGGCCAAAGAGTTGGGTGCCACTGAA
NM_000667.3       ATTGCGGTGGACATCAACAAGGACAAATTTGCAAAGGCCAAAGAGTTGGGTGCCACTGAA
                  ************************************************************

HsCD00622803      TGCATCAACCCTCAAGACTACAAGAAACCCATCCAGGAGGTGCTAAAGGAAATGACTGAT
NM_000668.5       TGCATCAACCCTCAAGACTACAAGAAACCCATTCAGGAAGTGCTAAAGGAAATGACTGAT
NM_000667.3       TGCATCAACCCTCAAGACTACAAGAAACCCATCCAGGAGGTGCTAAAGGAAATGACTGAT
                  ******************************** *****.*********************

HsCD00622803      GGAGGTGTGGATTTTTCATTTGAAGTCATCGGTCGGCTTGACACCATGATGGCTTCCCTG
NM_000668.5       GGAGGTGTGGATTTTTCGTTTGAAGTCATCGGTCGGCTTGACACCATGATGGCTTCCCTG
NM_000667.3       GGAGGTGTGGATTTTTCATTTGAAGTCATCGGTCGGCTTGACACCATGATGGCTTCCCTG
                  *****************.******************************************

HsCD00622803      TTATGTTGTCATGAGGCATGTGGCACAAGTGTCATCGTAGGGGTACCTCCTGATTCCCAA
NM_000668.5       TTATGTTGTCATGAGGCATGTGGCACAAGCGTCATCGTAGGGGTACCTCCTGCTTCCCAG
NM_000667.3       TTATGTTGTCATGAGGCATGTGGCACAAGTGTCATCGTAGGGGTACCTCCTGATTCCCAA
                  ***************************** **********************.******.

HsCD00622803      AACCTCTCAATGAACCCTATGCTGCTACTGACTGGACGTACCTGGAAGGGAGCTATTCTT
NM_000668.5       AACCTCTCAATAAACCCTATGCTGCTACTGACTGGACGCACCTGGAAGGGGGCTGTTTAT
NM_000667.3       AACCTCTCAATGAACCCTATGCTGCTACTGACTGGACGTACCTGGAAGGGAGCTATTCTT
                  ***********.************************** ***********.***.** :*

HsCD00622803      GGTGGCTTTAAAAGTAAAGAATGTGTCCCAAAACTTGTGGCTGATTTTATGGCTAAGAAG
NM_000668.5       GGTGGCTTTAAGAGTAAAGAAGGTATCCCAAAACTTGTGGCTGATTTTATGGCTAAGAAG
NM_000667.3       GGTGGCTTTAAAAGTAAAGAATGTGTCCCAAAACTTGTGGCTGATTTTATGGCTAAGAAG
                  ***********.********* **.***********************************

HsCD00622803      TTTTCATTGGATGCATTAATAACCCATGTTTTACCTTTTGAAAAAATAAATGAAGGATTT
NM_000668.5       TTTTCACTGGATGCGTTAATAACCCATGTTTTACCTTTTGAAAAAATAAATGAAGGATTT
NM_000667.3       TTTTCATTGGATGCATTAATAACCCATGTTTTACCTTTTGAAAAAATAAATGAAGGATTT
                  ****** *******.*********************************************

HsCD00622803      GACCTGCTTCACTCTGGGAAAAGTATCCGTACCATTCTGATGTTTTGA
NM_000668.5       GACCTGCTTCACTCTGGGAAAAGTATCCGTACCGTCCTGACGTTTTGA
NM_000667.3       GACCTGCTTCACTCTGGGAAAAGTATCCGTACCATTCTGATGTTTTGA
                  *********************************.* **** *******

Pathways

Reactome : Abacavir metabolism
Reactome : Abacavir transport and metabolism
Reactome : Biological oxidations
Reactome : Ethanol oxidation
Reactome : Metabolism
Reactome : Phase 1 - Functionalization of compounds
WikiPathway : Fatty Acid Omega Oxidation
WikiPathway : Vitamin A and carotenoid metabolism

Protein

HPRD : 00063

Clone

Cloning Information : 671180
Original Clone ID : ccsbBroadEn_00027

Organism


TAX_ID : 9606
Species Specific ID: 124

Genome

Chromosome : 4
Map Location : 4q23
Ensembl : ENSG00000187758