DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJFT7_nGST_DC-r2


Explanation of Terms

Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pJFT7_nGST_DC-r2              
Source: Center for Personalized Diagnostics
Description: In vitro expression vector with a T7 promoter and N-terminal TEV-cleavable Halo tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible
Comments: None
Publications: None
Authors: Arizona State University
Joshua LaBaer
Justin Saul
Ji Qiu
Fernanda Festa
Center for Personalized Diagnostics

Price:  Login for Pricing
No restriction
Special MTA: None



 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJFT7_nGST_DC-r2

pJFT7_nGST_DC-r2 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  GSTseqF
Reverse:  pCPD6268_R
Description: In vitro expression vector with a T7 promoter and N-terminal TEV-cleavable Halo tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible
Comments: One in a series of pJFT7 vectors made by J. Saul for IVTT protein expression at CPD. This vector has been modified to improve sequencing the insert with a reverse primer.
Size (bp): 6012
Parent Vector: None
Properties: Gateway, acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: Arizona State University
Joshua LaBaer
Justin Saul
Ji Qiu
Fernanda Festa
Center for Personalized Diagnostics
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin 3297 3979
death cassette ccdB ccdB death cassette (removed in plasmids containing a gene insert) 2572 2781
enhancer CITE CITE enhancer 17 515
primer forward primer GSTseqF forward sequencing primer GCAAGTATATAGCATGGCCT 1105 1124
primer reverse pCPD6268_R reverse sequencing primer agccaactcagcttccttt 2993 3011
promoter T7 T7 promoter 5997 6012
protease cleavage site TEV TEV protease cleavage site 1209 1229
recombination site attR1 attR1 recombination site 1245 1261
recombination site attR2 attR1 recombination site 2932 2947
reporter gene LacZ LacZ alpha 5833 5901
selectable marker AmpR Ampicillin resistance 4407 4736
selectable marker CmR chloramphenicol resistance (removed in plasmids containing a gene insert) 1478 2134
ssDNA origin f1 f1 origin 5505 5811
tag GST N-terminal GST tag 525 1190
trxn termination sequence T7 term T7 terminator 3069 3115


Species Specific ID: None
Target GenBank: None