Gene: |
Gene Symbol:
No insert Gene Name:  No insert |
---|---|
Original Clone ID: | None |
Type: | No insert |
Vector Name: | pRSET-natGFP |
Source: | Center for Membrane Proteins of Infectious Diseases |
Description: | Bacterial expression vector with a T7 promoter; adds C-terminal GFP tag; ampicillin resistance in bacteria; ligation independent cloning |
Comments: | None |
Publications: |
PMID: 24593131 Title: Purification and Biophysical Characterization of the CapA Membrane Protein FTT0807 from Francisella tularensis. PMID: 26908053 Title: Polyclonal Antibody Production for Membrane Proteins via Genetic Immunization |
Authors: |
Arizona State University Center for Membrane Proteins in Infectious Diseases PSI:Biology |
EvNO00623703 Price: Login for Pricing AVAILABLE No restriction Special MTA: PSI |
Distributed in bacterial strain : | DH5-alpha T1 phage resistant |
---|---|
Antibiotic Selection: |
Host Type:
bacterial
Marker:
ampicillin Bacterial Selection Condition: 100 ug/mL ampicillin Growth Condition: Growth with the single antibiotic in LB at 37 degrees is recommended. Comments: Commonly used conditions for ampicillin resistant plasmid clones. |
  Powered by LabGenius |
||
Vector Name: | pRSET-natGFP |
pRSET-natGFP in advanced viewed |
Synonyms: | '' | |
Sequencing Primer: | Forward:
T7
Reverse: GFPR |
|
Description: | Bacterial expression vector with a T7 promoter; adds C-terminal GFP tag; ampicillin resistance in bacteria; ligation independent cloning | |
Comments: | Based on Invitrogen pRSET B. Vector for subcloning to produce C-terminal GSAGSAAGSGEF linker + GFP tag. Insert not expressed due to ~0.5 kb BseRI-flanked sequence, containing stop codons in all three frames, between the RBS and GFP. Subclone using BseRI digestion and Clontech In-Fusion ligase-independent cloning. See Martin-Garcia et al 2014 Biochemistry 53:1958, PMID 24593131 | |
Size (bp): | 3980 | |
Parent Vector: | None | |
Properties: | bacterial expression, fluorescent marker, ligation independent cloning (LIC), with tag/fusion/marker | |
Author Name: |
Arizona State University Center for Membrane Proteins in Infectious Diseases PSI:Biology |
|
Publications: |
PMID:
24593131
Title: Purification and Biophysical Characterization of the CapA Membrane Protein FTT0807 from Francisella tularensis. |
|
Vector Map: |
![]() ![]() |
|
Sequence: |
Vector Features:
Type | Name | Description | Start Position | End Position |
---|---|---|---|---|
bacterial origin | pUC ori | pUC bacterial origin | 3080 | 3862 |
primer | reverse primer | GFPR reverse sequencing primer TCTCCACTGACAGAAAATTTGTGC | 642 | 665 |
promoter | T7 | T7 promoter | 20 | 39 |
ribosome binding site | RBS | Ribosome binding site | 85 | 92 |
selectable marker | AmpR | ampicillin resistance | 2125 | 2985 |
ssDNA origin | f1 | f1 origin | 1539 | 1994 |
tag | GFP | C-terminal rGFP tag | 568 | 1287 |
trxn termination sequence | T7 term | T7 terminator | 1339 | 1468 |
Species Specific ID: | None |
---|---|
Target GenBank: | None |