DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pRSET-natGFPHis

TOP

Explanation of Terms


Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pRSET-natGFPHis              
Source: Center for Membrane Proteins of Infectious Diseases
Description: Bacterial expression vector with a T7 promoter; adds C-terminal GFP-His6 tag; ampicillin resistance in bacteria; ligation independent cloning
Comments: None
Publications: PMID: 24593131
Title: Purification and Biophysical Characterization of the CapA Membrane Protein FTT0807 from Francisella tularensis.
PMID: 26908053
Title: Polyclonal Antibody Production for Membrane Proteins via Genetic Immunization
Authors: PSI:Biology
Arizona State University
Center for Membrane Proteins in Infectious Diseases
EvNO00623704

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pRSET-natGFPHis

pRSET-natGFPHis in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  T7
Reverse:  GFPR
Description: Bacterial expression vector with a T7 promoter; adds C-terminal GFP-His6 tag; ampicillin resistance in bacteria; ligation independent cloning
Comments: Based on Invitrogen pRSET B. Vector for subcloning to produce C-terminal GSAGSAAGSGEF linker + GFP tag. Insert not expressed due to ~0.5 kb BseRI-flanked sequence, containing stop codons in all three frames, between the RBS and GFP. Subclone using BseRI digestion and Clontech In-Fusion ligase-independent cloning. See Martin-Garcia et al 2014 Biochemistry 53:1958, PMID 24593131
Size (bp): 3998
Parent Vector: None
Properties: bacterial expression, fluorescent marker, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: PSI:Biology
Arizona State University
Center for Membrane Proteins in Infectious Diseases
Publications: PMID: 24593131
Title: Purification and Biophysical Characterization of the CapA Membrane Protein FTT0807 from Francisella tularensis.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC bacterial origin 3148 3821
primer reverse primer GFPR reverse sequencing primer TCTCCACTGACAGAAAATTTGTGC 642 665
promoter T7 T7 promoter 20 39
ribosome binding site RBS ribosomal binding site 85 92
selectable marker AmpR ampicillin resistance 2143 3003
ssDNA origin f1 f1 origin 1557 2012
tag GFP C-terminal GFP tag 568 1284
tag His C-terminal 6xHis tag 1585 1302
trxn termination sequence T7 term T7 terminator 1357 1486

 

Species Specific ID: None
Target GenBank: None