DNASU Plasmid Repository • 480.965.5697 | Email

Heavy Chain (Homo sapiens) & Light Chain (Homo sapiens) in RH2.2

TOP

Explanation of Terms


Gene 1: Gene Symbol:  Heavy Chain
Gene Name:  Heavy Chain
Gene 2: Gene Symbol:  Light Chain
Gene Name:  Light Chain
Sequence             
Original Clone ID: anti-ATF7-RAB-T2
Keyword: anti-ATF7-RAB-T2 recombinant antibody fab fragment
Species: Homo sapiens
Type: cDNA
Vector Name: RH2.2               Format:  FUSION
Source: Recombinant Antibody Network
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The University of Chicago
Recombinant Antibody Network
Protein Capture Reagents Program
HsCD00628862

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 774nts         Open reading frame : 1 to 774 & 1 to 756

ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAAC
GCGTACGCTGAGATCTCCGAGGTTCAGCTGGTGGAGTCTGGCGGTGGCCTGGTGCAGCCA
GGGGGCTCACTCCGTTTGTCCTGTGCAGCTTCTGGCTTCAACATCTATTCTTCTTCTATG
CACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCATCTATTTATCCTTAT
TCTAGCTATACTTCTTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACA
TCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTAT
TATTGTGCTCGCTACTACGCTTTGGACTACTGGGGTCAAGGAACCCTGGTCACCGTCTCC
TCGGCCTCCACCAAGGGTCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCT
GGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTG
TCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCC
TCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACCCAG
ACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTCGACAAGAAAGTTGAG
CCCAAATCTTGTGACAAAACTCACACATCTAGACACCACCACCACCACCACTAA



ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAAT
GCCTATGCATCCATGGCATCCGATATCCAGAAAACCCAGTCCCCGAGCTCCCTGTCCGCC
TCTGTGGGCGATAGGGTCACCATCACCTGCCGTGCCAGTCAGTCCGTGTCCAGCGCTGTA
GCCTGGTATCAACAGAAACCAGGAAAAGCTCCGAAGCTTCTGATTTACTCGGCATCCAGC
CTCTACTCTGGAGTCCCTTCTCGCTTCTCTGGTAGCCGTTCCGGGACGGATTTCACTCTG
ACCATCAGCAGTCTGCAGCCGGAAGACTTCGCAACTTATTACTGTCAGCAAGCTTACTAC
CTGATCACGTTCGGACAGGGTACCAAGGTGGAGATCAAACGAACTGTGGCTGCACCATCT
GTCTTCATCTTCCCGCCATCTGATTCACAGTTGAAATCTGGAACTGCCTCTGTTGTGTGC
CTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTC
CAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGC
CTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAAAAACATAAAGTCTACGCCTGC
GAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGT
GGTGATTCTGATTACAAAGATGACGATGACAAATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Expressed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: RH2.2
Synonyms: ''
Description: Recombinant antibody bacterial expression vector with His-tagged heavy chain; ampicillin resistance in bacteria
Comments: None
Size (bp): 7325
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, with tag/fusion/marker
Author Name: Recombinant Antibody Network
Publications: None
Vector Map:         Vector Sequence:
Sequence:



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 origin 5486 6105
gene fragment light chain Light chain 1534 2289
gene fragment heavy chain Heavy Chain 2408 3211
promoter tac promoter Tac promoter 1413 1441
repressor binding site LacI Lac I 78 1169
selectable marker AmpR Ampicillin resistance 6260 7120
ssDNA origin f1 f1 origin 4703 5009
tag His 6xHis tag 3188 3214

 

  • Protein
  • Clone

Protein

PCRP Binder Details : anti-ATF7-RAB-T2

Clone

Cloning Information : 670240
Original Clone ID : anti-ATF7-RAB-T2