DNASU Plasmid Repository • 480.965.5697 | Email

Heavy Chain (Homo sapiens) & Light Chain (Homo sapiens) in pSFV4

TOP

Explanation of Terms


Gene 1: Gene Symbol:  Heavy Chain
Gene Name:  Heavy Chain
Gene 2: Gene Symbol:  Light Chain
Gene Name:  Light Chain
Sequence             
Original Clone ID: anti-SMYD3-RAB-C232
Keyword: anti-SMYD3-RAB-C232 recombinant antibody fab fragment
Species: Homo sapiens
Type: cDNA
Vector Name: pSFV4               Format:  FUSION
Source: Recombinant Antibody Network
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The University of Chicago
Recombinant Antibody Network
Protein Capture Reagents Program
HsCD00628960

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 858nts         Open reading frame : 1 to 858 & 1 to 717

ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAAC
GCGTACGCTGAGATCTCCGAGGTTCAGCTGGTGGAGTCTGGCGGTGGCCTGGTGCAGCCA
GGGGGCTCACTCCGTTTGTCCTGTGCAGCTTCTGGCTTCAACGTCTCTTCTTCTTATATA
CACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCATCTATTTCTTCTTCT
TATGGCTATACTTATTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACA
TCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTAT
TATTGTGCTCGCGACTGGTCTCCGTACTCTCGTTACTACTACTCTTGGCCGATGTACTAC
GGTTTGGACTACTGGGGTCAAGGAACCCTGGTCACCGTCTCCTCGGCCTCCACCAAGGGT
CCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTG
GGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCC
CTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTC
AGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTG
AATCACAAGCCCAGCAACACCAAGGTCGACAAGAAAGTTGAGCCCAAATCTTGTGACAAA
ACTCACACAGGAGGTTCTGGCAGCGCCGGTGGCCTGAACGATATTTTTGAAGCGCAGAAA
ATTGAATGGCATGAATGA



ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAAT
GCCTATGCATCCGATATCCAGATGACCCAGTCCCCGAGCTCCCTGTCCGCCTCTGTGGGC
GATAGGGTCACCATCACCTGCCGTGCCAGTCAGTCCGTGTCCAGCGCTGTAGCCTGGTAT
CAACAGAAACCAGGAAAAGCTCCGAAGCTTCTGATTTACTCGGCATCCAGCCTCTACTCT
GGAGTCCCTTCTCGCTTCTCTGGTAGCCGTTCCGGGACGGATTTCACTCTGACCATCAGC
AGTCTGCAGCCGGAAGACTTCGCAACTTATTACTGTCAGCAAGTTCTGTACCAGCCGATC
ACGTTCGGACAGGGTACCAAGGTGGAGATCAAACGAACTGTGGCTGCACCATCTGTCTTC
ATCTTCCCGCCATCTGATTCACAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTG
AATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCG
GGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGC
AGCACCCTGACGCTGAGCAAAGCAGACTACGAAAAACATAAAGTCTACGCCTGCGAAGTC
ACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Expressed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSFV4
Synonyms: ''
Description: Bacterial expression vector for recombinant antibody expression with a Tac promoter and C-terminal Avi and His tag; ampicillin resistance in bacteria
Comments: None
Size (bp): 7834
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, loxP, with tag/fusion/marker
Author Name: Structural Genomics Consortium
Publications: None
Vector Map:         Vector Sequence:
Sequence:



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 origin 1612 2231
gene fragment light chain pelB leader sequence and the anitbody light chain 4796 5128
gene fragment heavy chain Heavy chain 5625 6470
promoter LacZ LacZ a reporter 2950 3109
promoter lac Lac promoter 3171 3200
promoter lac 2 Second lac promoter 4497 4520
promoter tac promoter Tac promoters 4607 4635
promoter tac promoter 2 second Tac promoter 4702 4730
recombination site LoxP LoxP site 5143 5176
repressor protein gene LacI Lac I 3249 4340
selectable marker AmpR Ampicillin resistance 597 1457
ssDNA origin f1 f1 origin 29 335
tag AviTag C-terminal Avi tag 6063 6473
tag His C-terminal 6xHis tag 7654 7671
trxn termination sequence TrpA TrpA terminator 6657 6684

 

  • Protein
  • Clone

Protein

PCRP Binder Details : anti-SMYD3-RAB-C232

Clone

Cloning Information : 670758
Original Clone ID : anti-SMYD3-RAB-C232