DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pCMVi-UB

TOP

Explanation of Terms


Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pCMVi-UB              
Source: Center for Membrane Proteins of Infectious Diseases
Description: Vector for antibody production in mice upon genetic immunization by gene gun with CMV promoter and N-terminal mouse ubiqiutin protein with Gly76Ala mutation; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: None
Publications: None
Authors: Arizona State University
Center for Membrane Proteins in Infectious Diseases
Kathryn Sykes
Stephen Johnston
EvNO00629006

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pCMVi-UB

pCMVi-UB in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  UBFOR
Reverse:  HGHTER
Description: Vector for antibody production in mice upon genetic immunization by gene gun with CMV promoter and N-terminal mouse ubiqiutin protein with Gly76Ala mutation; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: The mouse ubiquitin sequence contains the C-terminal Gly76Ala mutation to prevent de-ubiquination. Clone insert in-frame using the BglII restriction sites and another downstream site before the transcription terminator (such as XmaI)
Size (bp): 5218
Parent Vector: None
Properties: mammalian expression, multiple cloning site, with tag/fusion/marker
Author Name: Arizona State University
Kathryn Sykes
Stephen Johnston
Publications: PMID: 10433551
Title: Genetic live vaccines mimic the antigenicity but not pathogenicity of live viruses.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE CoE1 bacterial origin 2894 3750
gene fragment ubiquitin N-terminal mouse ubiquitin protein with Gly76Ala mutation 1250 1476
intron intron Intron 1028 1160
primer forward primer UBFOR sequencing primer AACATCCAGAAGGAGTCA 1427 1444
primer reverse primer HGHTER reverse sequencing primer ACTGGAGTGGCAACTTCCAGG 1594 1614
promoter CMV CMV promoter 174 915
selectable marker AmpR Ampicillin resistance 3760 4670
ssDNA origin f1 f1 origin 4752 5204
trxn regulatory element hGH hGH terminator 1556 2032

 

Species Specific ID: None
Target GenBank: None