DNASU Plasmid Repository • 480.965.5697 | Email

SLCO1A2 (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SLCO1A2
Gene Name:  solute carrier organic anion transporter family, member 1A2
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00629293

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1224nts         Open reading frame : 1 to 1224

ATGTTTCTGTTGGCAATAACATGTGCATTTGTATCCAAAACACTGTCTGGATCTTATATG
AATTCCATGCTCACACAAATAGAGAGACAATTCAACATCCCAACATCTCTAGTTGGATTC
ATTAATGGAAGCTTTGAGATTGGAAATCTTTTGTTGATTATATTTGTGAGTTATTTTGGA
ACCAAACTGCATAGACCTATAATGATTGGCATTGGATGTGTGGTTATGGGCTTAGGCTGT
TTCTTAAAATCACTACCTCATTTCCTCATGAACCAATATGAATATGAATCTACAGTTTCA
GTTTCAGGCAACTTGTCCTCAAACAGTTTCTTGTGTATGGAAAATGGAACCCAGATTTTA
AGACCAACGCAGGATCCATCAGAGTGTACAAAGGAAGTTAAATCATTAATGTGGGTGTAC
GTCCTAGTAGGCAATATTGTACGTGGAATGGGTGAAACTCCCATCCTGCCTTTGGGTATT
TCCTATATAGAAGATTTTGCCAAATTTGAAAATTCTCCTTTATATATTGGGCTTGTAGAA
ACAGGAGCTATTATTGGTCCTTTGATTGGACTTTTGTTGGCATCATTCTGTGCAAATGTT
TATGTTGACACTGGATTTGTGAACACAGATGATCTGATCATAACTCCCACTGACACTCGT
TGGGTCGGTGCATGGTGGTTTGGCTTTCTGATTTGTGCAGGAGTTAACGTGCTCACTGCC
ATTCCTTTTTTCTTTTTGCCCAACACACTTCCAAAGGAAGGACTAGAGACTAATGCTGAC
ATCATTAAAAATGAAAATGAAGACAAACAAAAAGAAGAGGTCAAGAAGGAAAAATATGGA
ATCACTAAAGATTTTCTACCTTTCATGAAAAGTCTTTCCTGCAATCCAATTTATATGCTT
TTCATACTTGTAAGTGTGATACAGTTCAATGCATTCGTTAACATGATCTCCTTCATGCCT
AAATACCTAGAACAGCAATATGGAATATCATCTTCAGATGCAATCTTTCTAATGGGTATT
TATAACTTACCTCCAATATGTATTGGATATATAATTGGTGGTTTAATTATGAAGAAGTTC
AAGATTACTGTCAAACAAGCTGCCCACATAGGATGTTGGTTATCCTTACTTGAGTATCTT
CTCTATTTTTTATCTTTTCTCATGACTTGTGAAAATTCTTCAGTTGTTGGAATAAATACC
TCTTATGAAGGGTATGTTGTTTTC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome

Gene

 

Gene Symbol : SLCO1A2
Symbol Nomenclature : SLCO1A2
SYNONYM : OATP; OATP-A; OATP1A2; SLC21A3
Designation : OATP-1|organic anion transporting polypeptide A|organic anion-transporting polypeptide 1|sodium-independent organic anion transporter|solute carrier family 21 (organic anion transporter), member 3|solute carrier family 21 member 3|solute carrier organic anion transporter family member 1A2
Full Nomenclature : solute carrier organic anion transporter family, member 1A2
GENEID : 6579
HGNC : 10956
MIM : 602883
Vega : OTTHUMG00000156259
Target GenBank: None

 

Pathways

Reactome : Bile acid and bile salt metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Recycling of bile acids and salts
Reactome : SLC-mediated transmembrane transport
Reactome : Transmembrane transport of small molecules
Reactome : Transport of organic anions
Reactome : Transport of vitamins, nucleosides, and related molecules

Protein

HPRD : 09112

Clone

Cloning Information : 674736

Organism


TAX_ID : 9606
Species Specific ID: 6579

Genome

Chromosome : 12
Map Location : 12p12
Ensembl : ENSG00000084453