DNASU Plasmid Repository • 480.965.5697 | Email

HIF1A (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HIF1A
Gene Name:  hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00631090

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2478nts         Open reading frame : 1 to 2478

ATGGAGGGCGCTGGCGGCGCGAACGACAAGAAAAAGATAAGTTCTGAACGTCGAAAAGAA
AAGTCTCGAGATGCAGCCAGATCTCGGCGAAGTAAAGAATCTGAAGTTTTTTATGAGCTT
GCTCATCAGTTGCCACTTCCACATAATGTGAGTTCGCATCTTGATAAGGCCTCTGTGATG
AGGCTTACCATCAGCTATTTGCGTGTGAGGAAACTTCTGGATGCTGGTGATTTGGATATT
GAAGATGACATGAAAGCACAGATGAATTGCTTTTATTTGAAAGCCTTGGATGGTTTTGTT
ATGGTTCTCACAGATGATGGTGACATGATTTACATTTCTGATAATGTGAACAAATACATG
GGATTAACTCAGTTTGAACTAACTGGACACAGTGTGTTTGATTTTACTCATCCATGTGAC
CATGAGGAAATGAGAGAAATGCTTACACACAGAAATGGCCTTGTGAAAAAGGGTAAAGAA
CAAAACACACAGCGAAGCTTTTTTCTCAGAATGAAGTGTACCCTAACTAGCCGAGGAAGA
ACTATGAACATAAAGTCTGCAACATGGAAGGTATTGCACTGCACAGGCCACATTCACGTA
TATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCTATGACCTGCTTG
GTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCTTTAGATAGCAAG
ACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGATGAAAGAATTACC
GAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTATGAATATTATCAT
GCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACTAAAGGACAAGTC
ACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGGGTTGAAACTCAA
GCAACTGTCATATATAACACCAAGAATTCTCAACCACAGTGCATTGTATGTGTGAATTAC
GTTGTGAGTGGTATTATTCAGCACGACTTGATTTTCTCCCTTCAACAAACAGAATGTGTC
CTTAAACCGGTTGAATCTTCAGATATGAAAATGACTCAGCTATTCACCAAAGTTGAATCA
GAAGATACAAGTAGCCTCTTTGACAAACTTAAGAAGGAACCTGATGCTTTAACTTTGCTG
GCCCCAGCCGCTGGAGACACAATCATATCTTTAGATTTTGGCAGCAACGACACAGAAACT
GATGACCAGCAACTTGAGGAAGTACCATTATATAATGATGTAATGCTCCCCTCACCCAAC
GAAAAATTACAGAATATAAATTTGGCAATGTCTCCATTACCCACCGCTGAAACGCCAAAG
CCACTTCGAAGTAGTGCTGACCCTGCACTCAATCAAGAAGTTGCATTAAAATTAGAACCA
AATCCAGAGTCACTGGAACTTTCTTTTACCATGCCCCAGATTCAGGATCAGACACCTAGT
CCTTCCGATGGAAGCACTAGACAAAGTTCACCTGAGCCTAATAGTCCCAGTGAATATTGT
TTTTATGTGGATAGTGATATGGTCAATGAATTCAAGTTGGAATTGGTAGAAAAACTTTTT
GCTGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGACACAGATTTAGACTTGGAG
ATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCCTTCGATCAGTTG
TCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAAAGCACAGTTACA
GTATTCCAGCAGACTCAAATACAAGAACCTACTGCTAATGCCACCACTACCACTGCCACC
ACTGATGAATTAAAAACAGTGACAAAAGACCGTATGGAAGACATTAAAATATTGATTGCA
TCTCCATCTCCTACCCACATACATAAAGAAACTACTAGTGCCACATCATCACCATATAGA
GATACTCAAAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTCATAGAACAGACA
GAAAAATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGAGTCAAAGAACTACA
GTTCCTGAGGAAGAACTAAATCCAAAGATACTAGCTTTGCAGAATGCTCAGAGAAAGCGA
AAAATGGAACATGATGGTTCACTTTTTCAAGCAGTAGGAATTGGAACATTATTACAGCAG
CCAGACGATCATGCAGCTACTACATCACTTTCTTGGAAACGTGTAAAAGGATGCAAATCT
AGTGAACAGAATGGAATGGAGCAAAAGACAATTATTTTAATACCCTCTGATTTAGCATGT
AGACTGCTGGGGCAATCAATGGATGAAAGTGGATTACCACAGCTGACCAGTTATGATTGT
GAAGTTAATGCTCCTATACAAGGCAGCAGAAACCTACTGCAGGGTGAAGAATTACTCAGA
GCTTTGGATCAAGTTAAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome

Gene

 

Gene Symbol : HIF1A
Symbol Nomenclature : HIF1A
SYNONYM : HIF-1A; HIF-1alpha; HIF1; HIF1-ALPHA; MOP1; PASD8; bHLHe78
Designation : ARNT interacting protein|ARNT-interacting protein|HIF-1-alpha|PAS domain-containing protein 8|basic-helix-loop-helix-PAS protein MOP1|class E basic helix-loop-helix protein 78|hypoxia-inducible factor 1 alpha isoform I.3|hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)|hypoxia-inducible factor 1-alpha|hypoxia-inducible factor1alpha|member of PAS protein 1|member of PAS superfamily 1
Full Nomenclature : hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
GENEID : 3091
HGNC : 4910
MIM : 603348
Vega : OTTHUMG00000140344
Target GenBank: None

 

Pathways

NCI : AP-1 transcription factor network
NCI : HIF-1-alpha transcription factor network
NCI : Hypoxic and oxygen homeostasis regulation of HIF-1-alpha
NCI : Notch-mediated HES/HEY network
NCI : VEGFR1 specific signals
Panther : Angiogenesis
Panther : Hypoxia response via HIF activation
Panther : VEGF signaling pathway
Reactome : Cellular response to hypoxia
Reactome : Cellular responses to stress
Reactome : Circadian Clock
Reactome : Disease
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : NOTCH1 Intracellular Domain Regulates Transcription
Reactome : Oxygen-dependent asparagine hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Oxygen-dependent proline hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Regulation of Hypoxia-inducible Factor (HIF) by oxygen
Reactome : Regulation of gene expression by Hypoxia-inducible Factor
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
WikiPathway : Adipogenesis
WikiPathway : Angiogenesis
WikiPathway : Notch Signaling Pathway

Protein

HPRD : 04517

Clone

Cloning Information : 676096

Organism


TAX_ID : 9606
Species Specific ID: 3091

Genome

Chromosome : 14
Map Location : 14q23.2
Ensembl : ENSG00000100644