DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pCMVi-LS


Explanation of Terms

Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pCMVi-LS              
Source: Center for Membrane Proteins of Infectious Diseases
Description: with tag/fusion/marker assay, multiple cloning site clone, bacterial expression expression with leader sequence and MCS and intron and hGH and forward primer and AmpR and ColE and f1 and reverse primer and DTH and -10/Spec-R and Stop Codons and CMV and SV40; ampicillin resistance in bacterial;
Comments: None
Publications: None
Authors: PSI:Biology
Arizona State University
Center for Membrane Proteins in Infectious Diseases
Center for Innovations in Medicine

Price:  Login for Pricing
No restriction
Special MTA: PSI



 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pCMVi-LS

pCMVi-LS in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  LSFOR
Reverse:  HGHTER
Description: with tag/fusion/marker assay, multiple cloning site clone, bacterial expression expression with leader sequence and MCS and intron and hGH and forward primer and AmpR and ColE and f1 and reverse primer and DTH and -10/Spec-R and Stop Codons and CMV and SV40; ampicillin resistance in bacterial;
Comments: Clone insert in-frame using the BglII restriction sites and another downstream site before the transcription terminator (such as XmaI)
Size (bp): 5067
Parent Vector: None
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: PSI:Biology
Arizona State University
Center for Innovations in Medicine
Publications: PMID: 10433551
Title: Genetic live vaccines mimic the antigenicity but not pathogenicity of live viruses.

PMID: 19800089
Title: New classes of orthopoxvirus vaccine candidates by functionally screening a synthetic library for protective antigens

Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
-10 signal -10/Spec-R 0 0
3' Clip DTH 1024 1893
MCS MCS Multiple cloning site; clone insert in-frame using multiple cloning site with BglII, KpnI, MluI, ClaI, SalI, XbaI, BamHI, SmaI 1155 1233
Miscellaneous Feature Stop Codons 1219 1224
Origin SV40 1910 2217
bacterial origin ColE ColE1 origin 2574 3430
intron intron 857 989
leader sequence leader sequence N-terminal "LS" = secretion leader sequence from human alpha1-antitrypsin 1081 1152
primer forward primer LSFOR forward sequencing primer TTCTGTCTCGTGGGGCAT 1089 1106
primer reverse primer HGHTER reverse sequencing primer ACTGGAGTGGCAACTTCCAGG 1272 1292
promoter CMV CMV promoter 1 744
selectable marker AmpR ampicillin resistance 3440 4350
ssDNA origin f1 f1 origin 4332 4873
trxn termination sequence hGH hGH terminator 1234 1710


Species Specific ID: None
Target GenBank: None