| Gene: |
Gene Symbol:
No insert Gene Name: No insert |
|---|---|
| Original Clone ID: | None |
| Type: | No insert |
| Vector Name: | pCDF-BAD |
| Source: | Center for Membrane Proteins of Infectious Diseases |
| Description: | Arabinose-inducible expression in bacteria; spectinomycin resistance in bacteria; ligation into multiple cloning site downstream of RBS: NdeI, XhoI/SciI, AscI, ZraI/AatII; or just upstream of RBS: EagI/NotI, PmeI |
| Comments: | None |
| Publications: |
PMID: 26908053 Title: Polyclonal Antibody Production for Membrane Proteins via Genetic Immunization |
| Authors: |
Arizona State University Medical University of South Carolina Debra T. Hansen Jeffrey L. Hansen Thirumagal Thiyagarajan Center for Membrane Proteins in Infectious Diseases |
|
EvNO00631285 Price: Login for Pricing AVAILABLE No restriction Special MTA: PSI |
| Distributed in bacterial strain : | DH5-alpha T1 phage resistant |
|---|---|
| Antibiotic Selection: |
Host Type:
bacterial
Marker:
spectinomycin Bacterial Selection Condition: 100 ug/mL spectinomycin Growth Condition: Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin. Comments: None |
Powered by LabGenius |
||
| Vector Name: | pCDF-BAD |
pCDF-BAD in advanced viewed |
| Synonyms: | '' | |
| Sequencing Primer: | Forward:
ARAC5R
Reverse: T7 terminator |
|
| Description: | Arabinose-inducible expression in bacteria; spectinomycin resistance in bacteria; ligation into multiple cloning site downstream of RBS: NdeI, XhoI/SciI, AscI, ZraI/AatII; or just upstream of RBS: EagI/NotI, PmeI | |
| Comments: | For arabinose-inducible expression of the insert, on a vector that is compatible with most other cloning vectors (non-ColE1 origin of replication; Clone by ligation into multiple cloning site downstream of RBS: NdeI, XhoI/SciI, AscI, ZraI/AatII; or just upstream of RBS: EagI/NotI, PmeI | |
| Size (bp): | 3552 | |
| Parent Vector: | None | |
| Properties: | bacterial expression, multiple cloning site, with tag/fusion/marker | |
| Author Name: |
Arizona State University Medical University of South Carolina Debra T. Hansen Jeffrey L. Hansen Thirumagal Thiyagarajan |
|
| Publications: | None | |
| Vector Map: |
Vector Sequence:
|
|
| Sequence: |
Vector Features:
| Type | Name | Description | Start Position | End Position |
|---|---|---|---|---|
| bacterial origin | CloDF13 | CloDF13 origin | 2792 | 3530 |
| primer | forward primer | ARAC5R forward sequencing primer GGGATCATTTTGCGCTTCAG | 694 | 683 |
| promoter | araC promoter | araC promoter | 1138 | 1166 |
| promoter | arabinose BAD | arabinose BAD promoter | 1263 | 1290 |
| repressor binding site | arabinose O2 operator | arabinose O2 operator | 1016 | 1033 |
| repressor protein gene | araC | araC | 109 | 987 |
| ribosome binding site | RBS | ribosome binding site | 2658 | 2662 |
| selectable marker | SpectR | Spectinomycin, streptomycin resistance | 2717 | 2722 |
| trxn termination sequence | T7 term | T7 terminator | 1643 | 1690 |
| Species Specific ID: | None |
|---|---|
| Target GenBank: | None |
