DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pCDF-BAD


Explanation of Terms

Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pCDF-BAD              
Source: Center for Membrane Proteins of Infectious Diseases
Description: Arabinose-inducible expression in bacteria; spectinomycin resistance in bacteria; ligation into multiple cloning site downstream of RBS: NdeI, XhoI/SciI, AscI, ZraI/AatII; or just upstream of RBS: EagI/NotI, PmeI
Comments: None
Publications: PMID: 26908053
Title: Polyclonal Antibody Production for Membrane Proteins via Genetic Immunization
Authors: Arizona State University
Medical University of South Carolina
Debra T. Hansen
Jeffrey L. Hansen
Thirumagal Thiyagarajan
Center for Membrane Proteins in Infectious Diseases

Price:  Login for Pricing
No restriction
Special MTA: PSI



 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pCDF-BAD

pCDF-BAD in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  ARAC5R
Reverse:  T7 terminator
Description: Arabinose-inducible expression in bacteria; spectinomycin resistance in bacteria; ligation into multiple cloning site downstream of RBS: NdeI, XhoI/SciI, AscI, ZraI/AatII; or just upstream of RBS: EagI/NotI, PmeI
Comments: For arabinose-inducible expression of the insert, on a vector that is compatible with most other cloning vectors (non-ColE1 origin of replication; Clone by ligation into multiple cloning site downstream of RBS: NdeI, XhoI/SciI, AscI, ZraI/AatII; or just upstream of RBS: EagI/NotI, PmeI
Size (bp): 3552
Parent Vector: None
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Arizona State University
Medical University of South Carolina
Debra T. Hansen
Jeffrey L. Hansen
Thirumagal Thiyagarajan
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin CloDF13 CloDF13 origin 2792 3530
primer forward primer ARAC5R forward sequencing primer GGGATCATTTTGCGCTTCAG 694 683
promoter araC promoter araC promoter 1138 1166
promoter arabinose BAD arabinose BAD promoter 1263 1290
repressor binding site arabinose O2 operator arabinose O2 operator 1016 1033
repressor protein gene araC araC 109 987
ribosome binding site RBS ribosome binding site 2658 2662
selectable marker SpectR Spectinomycin, streptomycin resistance 2717 2722
trxn termination sequence T7 term T7 terminator 1643 1690


Species Specific ID: None
Target GenBank: None