DNASU Plasmid Repository • 480.965.5697 | Email

ATM (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ATM
Gene Name:  ataxia telangiectasia mutated
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00639805

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 393nts         Open reading frame : 1 to 393

ATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAGAGCACTGACCTCTGTGACTTT
TCAGGGGATTTGGATCCTGCTCCTAATCCACCTCATTTTCCATCGCATGTGATTAAAGCA
ACATTTGCCTATATCAGCAATTGTCATAAAACCAAGTTAAAAAGCATTTTAGAAATTCTT
TCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTTGCCATATGTGAGCAAGCAGCTGAA
ACAAATAATGTTTATAAGAAGCACAGAATTCTTAAAATATATCACCTGTTTGTTAGTTTA
TTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCTTGGGCCTTTGTTCTTCGAGACGTT
ATTTATACTTTGATTCACTATATCAACCAAAGG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome

Gene

 

Gene Symbol : ATM
Symbol Nomenclature : ATM
SYNONYM : AT1; ATA; ATC; ATD; ATDC; ATE; TEL1; TELO1
Designation : A-T mutated|AT mutated|TEL1, telomere maintenance 1, homolog|serine-protein kinase ATM
Full Nomenclature : ataxia telangiectasia mutated
GENEID : 472
HGNC : 795
MIM : 607585
Vega : OTTHUMG00000166480
Target GenBank: None

 

Pathways

NCI : ATM pathway
NCI : BARD1 signaling events
NCI : Canonical NF-kappaB pathway
NCI : E2F transcription factor network
NCI : Fanconi anemia pathway
NCI : Regulation of Telomerase
NCI : Validated transcriptional targets of deltaNp63 isoforms
NCI : p38 MAPK signaling pathway
NCI : p53 pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cellular Senescence
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Fanconi Anemia pathway
Reactome : G1/S DNA Damage Checkpoints
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of the Fanconi anemia pathway
Reactome : Stabilization of p53
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : G1 to S cell cycle control
WikiPathway : Homologous recombination
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Ovarian Infertility Genes
WikiPathway : TP53 network
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

HPRD : 06347

Clone

Cloning Information : 692059

Organism


TAX_ID : 9606
Species Specific ID: 472

Genome

Chromosome : 11
Map Location : 11q22-q23
Ensembl : ENSG00000149311