DNASU Plasmid Repository • 480.965.5697 | Email

TPK1 (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TPK1
Gene Name:  thiamin pyrophosphokinase 1
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00640163

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 729nts         Open reading frame : 1 to 729

ATGGAGCATGCCTTTACCCCGTTGGAGCCCCTGCTTTCCACTGGGAATTTGAAGTACTGC
CTTGTAATTCTTAATCAGCCTTTGGACAACTATTTTCGTCATCTTTGGAACAAAGCTCTT
TTAAGAGCCTGTGCCGATGGAGGTGCCAACCGCTTATATGATATCACCGAAGGAGAGAGA
GAAAGCTTTTTGCCTGAATTCATCAATGGAGACTTTGATTCTATTAGGCCTGAAGTCAGA
GAATACTATGCTACTAAGGGATGTGAGCTCATTTCAACTCCTGATCAAGACCACACTGAC
TTTACTAAGTGCCTTAAAATGCTCCAAAAGAAGATAGAAGAAAAAGACTTAAAGGTTGAT
GTGATCGTGACACTGGGAGGCCTTGCTGGGCGTTTTGACCAGATTATGGCATCTGTGAAT
ACCTTGTTCCAAGCGACTCACATCACTCCTTTTCCAATTATAATAATCCAAGAGGAATCG
CTGATCTACCTGCTCCAACCAGGAAAGCACAGGTTGCATGTAGACACTGGAATGGAGGGT
GATTGGTGTGGCCTTATTCCTGTTGGACAGCCTTGTAGTCAGGTTACAACCACAGGCCTC
AAGTGGAACCTCACAAATGATGTGCTTGCTTTTGGAACATTGGTCAGTACTTCCAATACC
TACGACGGGTCTGGTGTTGTGACTGTGGAAACTGACCACCCACTCCTCTGGACCATGGCC
ATCAAAAGC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome

Gene

 

Gene Symbol : TPK1
Symbol Nomenclature : TPK1
SYNONYM : HTPK1; PP20; THMD5
Designation : placental protein 20|thiamine diphosphokinase|thiamine kinase
Full Nomenclature : thiamin pyrophosphokinase 1
GENEID : 27010
GenBank Accession : NM_022445
HGNC : 17358
MIM : 606370
Vega : OTTHUMG00000152774
Target GenBank: NM_022445

 

Pathways

Panther : Thiamin metabolism
Reactome : Defective AMN causes hereditary megaloblastic anemia 1
Reactome : Defective BTD causes biotidinase deficiency
Reactome : Defective CD320 causes methylmalonic aciduria
Reactome : Defective CUBN causes hereditary megaloblastic anemia 1
Reactome : Defective GIF causes intrinsic factor deficiency
Reactome : Defective HLCS causes multiple carboxylase deficiency
Reactome : Defective LMBRD1 causes methylmalonic aciduria and homocystinuria type cblF
Reactome : Defective MMAA causes methylmalonic aciduria type cblA
Reactome : Defective MMAB causes methylmalonic aciduria type cblB
Reactome : Defective MMACHC causes methylmalonic aciduria and homocystinuria type cblC
Reactome : Defective MMADHC causes methylmalonic aciduria and homocystinuria type cblD
Reactome : Defective MTR causes methylmalonic aciduria and homocystinuria type cblG
Reactome : Defective MTRR causes methylmalonic aciduria and homocystinuria type cblE
Reactome : Defective MUT causes methylmalonic aciduria mut type
Reactome : Defective TCN2 causes hereditary megaloblastic anemia
Reactome : Defects in biotin (Btn) metabolism
Reactome : Defects in cobalamin (B12) metabolism
Reactome : Defects in vitamin and cofactor metabolism
Reactome : Disease
Reactome : Metabolism
Reactome : Metabolism of vitamins and cofactors
Reactome : Metabolism of water-soluble vitamins and cofactors
Reactome : Vitamin B1 (thiamin) metabolism

Protein

HPRD : 06967

Clone

Cloning Information : 676903

Organism


TAX_ID : 9606
Species Specific ID: 27010

Genome

Chromosome : 7
Map Location : 7q34-q35
Ensembl : ENSG00000196511