DNASU Plasmid Repository • 480.965.5697 | Email

ZSCAN30 (Homo sapiens) in pET15Avi6HT_NESG

TOP

Explanation of Terms


Gene: Gene Symbol:  ZSCAN30
Gene Name:  zinc finger and SCAN domain containing 30
Sequence             
Original Clone ID: None
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15Avi6HT_NESG               Format:  CLOSED
Source: Rutgers University
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00651849

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 291nts        
Open reading frame : 1 to 291

GAAAACCCCTGGAGCCAAGAGGTATTCCGGCAGAAGTTCAGGCAGTTTAGTTACTCTGAC
TCCACTGGCCCTCGGGAGGCTCTGAGCCGGCTGCGAGAGCTTTGCTGTCAGTGGTTGAGG
CCGGAGGTGCACTCCAAGGAGCAGATCCTGGAGCTGCTGATGTTGGAGCAGTTCCTGGCC
ATCCTTCCTGAGGAGCTGCAAGCTTGGCTGCGAGAGCATCGGCCAGAGAATGGAGAGGAA
GCTGTGACTATGCTGGAGGAGCTGGAAAAAGAACTGGAGGAGCCAAGGTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15Avi6HT_NESG

pET15Avi6HT_NESG in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression vector with T7 lac promoter, N-terminal TEV-cleavable Avi-tag and 6XHis-tag; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: None
Size (bp): 5789
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Rutgers University
Gaetano T. Montleione
Thomas B. Acton
Stephen Anderson
Northeast Structural Genomics Consortium
PSI:Biology
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3944 4626
promoter T7 T7 promoter 541 560
protease cleavage site TEV TEV protease cleavage site 387 404
repressor binding site lac operator Lac operator 519 541
repressor protein gene LacI Lac repressor 3344 3520
selectable marker AmpR ampicillin resistance 4724 5383
tag His N-terminal 6xHis tag 405 422
tag AviTag Avi Tag 423 466
trxn termination sequence T7 term T7 terminator 217 263

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome

Gene

 

Gene Symbol : ZSCAN30
Symbol Nomenclature : ZSCAN30
SYNONYM : ZNF-WYM; ZNF397OS; ZNF917
Designation : ZNF397 opposite strand|zinc finger and SCAN domain-containing protein 30|zinc finger protein 397 opposite strand|zinc finger protein 397OS
Full Nomenclature : zinc finger and SCAN domain containing 30
GENEID : 100101467
HGNC : 33517
Vega : OTTHUMG00000178569
Target GenBank: None

 

Protein

Structural Annotation Wiki : HR6932A
UniProt : Q86W11

Clone

Cloning Information : 678410

Experimental

TargetTrack - Experimental data : HR6932A

Organism


TAX_ID : 9606
Species Specific ID: 100101467

Genome

Chromosome : 18
Map Location : 18q12.2
Ensembl : ENSG00000186814