DNASU Plasmid Repository • 480.965.5697 | Email

PGR (Homo sapiens) in pET15Avi6HT_NESG

TOP

Explanation of Terms


Gene: Gene Symbol:  PGR
Gene Name:  progesterone receptor
Sequence             
Original Clone ID: None
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15Avi6HT_NESG               Format:  FUSION
Source: Rutgers University
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Stephen Anderson
Elliot Campbell
Rutgers University
Protein Capture Reagents Program
HsCD00651871

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 606nts        
Open reading frame : 1 to 606

CTTAATCAACTAGGCGAGAGGCAACTTCTTTCAGTAGTCAAGTGGTCTAAATCATTGCCA
GGTTTTCGAAACTTACATATTGATGACCAGATAACTCTCATTCAGTATTCTTGGATGAGC
TTAATGGTGTTTGGTCTAGGATGGAGATCCTACAAACACGTCAGTGGGCAGATGCTGTAT
TTTGCACCTGATCTAATACTAAATGAACAGCGGATGAAAGAATCATCATTCTATTCATTA
TGCCTTACCATGTGGCAGATCCCACAGGAGTTTGTCAAGCTTCAAGTTAGCCAAGAAGAG
TTCCTCTGTATGAAAGTATTGTTACTTCTTAATACAATTCCTTTGGAAGGGCTACGAAGT
CAAACCCAGTTTGAGGAGATGAGGTCAAGCTACATTAGAGAGCTCATCAAGGCAATTGGT
TTGAGGCAAAAAGGAGTTGTGTCGAGCTCACAGCGTTTCTATCAACTTACAAAACTTCTT
GATAACTTGCATGATCTTGTCAAACAACTTCATCTGTACTGCTTGAATACATTTATCCAG
TCCCGGGCACTGAGTGTTGAATTTCCAGAAATGATGTCTGAAGTTATTGCTGCACAATTA
CCCTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15Avi6HT_NESG

pET15Avi6HT_NESG in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression vector with T7 lac promoter, N-terminal TEV-cleavable Avi-tag and 6XHis-tag; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: None
Size (bp): 5789
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Rutgers University
Gaetano T. Montleione
Thomas B. Acton
Stephen Anderson
Northeast Structural Genomics Consortium
PSI:Biology
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3944 4626
promoter T7 T7 promoter 541 560
protease cleavage site TEV TEV protease cleavage site 387 404
repressor binding site lac operator Lac operator 519 541
repressor protein gene LacI Lac repressor 3344 3520
selectable marker AmpR ampicillin resistance 4724 5383
tag His N-terminal 6xHis tag 405 422
tag AviTag Avi Tag 423 466
trxn termination sequence T7 term T7 terminator 217 263

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome

Gene

 

Gene Symbol : PGR
Symbol Nomenclature : PGR
SYNONYM : NR3C3; PR
Designation : nuclear receptor subfamily 3 group C member 3
Full Nomenclature : progesterone receptor
GENEID : 5241
HGNC : 8910
MIM : 607311
Vega : OTTHUMG00000167531
Target GenBank: None

 

Pathways

NCI : Cellular roles of Anthrax toxin
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Nuclear Receptor transcription pathway
Reactome : Nuclear signaling by ERBB4
Reactome : Signal Transduction
Reactome : Signaling by ERBB4
WikiPathway : Nuclear Receptors
WikiPathway : Ovarian Infertility Genes

Protein

Structural Annotation Wiki : HR4675E
UniProt : P06401
HPRD : 07077

Clone

Cloning Information : 678432

Experimental

TargetTrack - Experimental data : HR4675E

Organism


TAX_ID : 9606
Species Specific ID: 5241

Genome

Chromosome : 11
Map Location : 11q22-q23
Ensembl : ENSG00000082175