DNASU Plasmid Repository • 480.965.5697 | Email

NR4A1 (Homo sapiens) in pET15Avi6HT_NESG

TOP

Explanation of Terms


Gene: Gene Symbol:  NR4A1
Gene Name:  nuclear receptor subfamily 4, group A, member 1
Sequence             
Original Clone ID: None
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15Avi6HT_NESG               Format:  FUSION
Source: Rutgers University
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Stephen Anderson
Elliot Campbell
Rutgers University
Protein Capture Reagents Program
HsCD00651875

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 597nts        
Open reading frame : 1 to 597

GGGGATGTACAGCAGTTCTACGACCTGCTCTCCGGTTCTCTGGAGGTCATCCGCAAGTGG
GCGGAGAAGATCCCTGGCTTTGCTGAGCTGTCACCGGCTGACCAGGACCTGTTGCTGGAG
TCGGCCTTCCTGGAGCTCTTCATCCTCCGCCTGGCGTACAGGTCTAAGCCAGGCGAGGGC
AAGCTCATCTTCTGCTCAGGCCTGGTGCTACACCGGCTGCAGTGTGCCCGTGGCTTCGGG
GACTGGATTGACAGTATCCTGGCCTTCTCAAGGTCCCTGCACAGCTTGCTTGTCGATGTC
CCTGCCTTCGCCTGCCTCTCTGCCCTTGTCCTCATCACCGACCGGCATGGGCTGCAGGAG
CCGCGGCGGGTGGAGGAGCTGCAGAACCGCATCGCCAGCTGCCTGAAGGAGCACGTGGCA
GCTGTGGCGGGCGAGCCCCAGCCAGCCAGCTGCCTGTCACGTCTGTTGGGCAAACTGCCC
GAGCTGCGGACCCTGTGCACCCAGGGCCTGCAGCGCATCTTCTACCTCAAGCTGGAGGAC
TTGGTGCCCCCTCCACCCATCATTGACAAGATCTTCATGGACACGCTGCCCTTCTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15Avi6HT_NESG

pET15Avi6HT_NESG in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression vector with T7 lac promoter, N-terminal TEV-cleavable Avi-tag and 6XHis-tag; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: None
Size (bp): 5789
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Rutgers University
Gaetano T. Montleione
Thomas B. Acton
Stephen Anderson
Northeast Structural Genomics Consortium
PSI:Biology
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3944 4626
promoter T7 T7 promoter 541 560
protease cleavage site TEV TEV protease cleavage site 387 404
repressor binding site lac operator Lac operator 519 541
repressor protein gene LacI Lac repressor 3344 3520
selectable marker AmpR ampicillin resistance 4724 5383
tag His N-terminal 6xHis tag 405 422
tag AviTag Avi Tag 423 466
trxn termination sequence T7 term T7 terminator 217 263

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome

Gene

 

Gene Symbol : NR4A1
Symbol Nomenclature : NR4A1
SYNONYM : GFRP1; HMR; N10; NAK-1; NGFIB; NP10; NUR77; TR3
Designation : ST-59|TR3 orphan receptor|early response protein NAK1|growth factor-inducible nuclear protein N10|hormone receptor|nerve growth factor IB nuclear receptor variant 1|nuclear hormone receptor NUR/77|nuclear receptor subfamily 4 group A member 1|orphan nuclear receptor HMR|orphan nuclear receptor TR3|steroid receptor TR3|testicular receptor 3
Full Nomenclature : nuclear receptor subfamily 4, group A, member 1
GENEID : 3164
HGNC : 7980
MIM : 139139
Vega : OTTHUMG00000150393
Target GenBank: None

 

Pathways

NCI : Glucocorticoid receptor regulatory network
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : RXR and RAR heterodimerization with other nuclear receptor
Reactome : Adaptive Immune System
Reactome : AKT phosphorylates targets in the nucleus
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Immune System
Reactome : Innate Immune System
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear Receptor transcription pathway
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT activation
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PIP3 activates AKT signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : MAPK signaling pathway
WikiPathway : Nuclear Receptors

Protein

Structural Annotation Wiki : HR4793C
UniProt : P22736
HPRD : 00744

Clone

Cloning Information : 678436

Experimental

TargetTrack - Experimental data : HR4793C

Organism


TAX_ID : 9606
Species Specific ID: 3164

Genome

Chromosome : 12
Map Location : 12q13
Ensembl : ENSG00000123358