DNASU Plasmid Repository • 480.965.5697 | Email

SMYD2 (Homo sapiens) in pET15Avi6HT_NESG

TOP

Explanation of Terms


Gene: Gene Symbol:  SMYD2
Gene Name:  SET and MYND domain containing 2
Sequence             
Original Clone ID: None
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15Avi6HT_NESG               Format:  FUSION
Source: Rutgers University
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Stephen Anderson
Elliot Campbell
Rutgers University
Protein Capture Reagents Program
HsCD00651948

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 714nts        
Open reading frame : 1 to 714

GGCCTGGAGCGCTTCTGCAGCCCGGGCAAAGGCCGGGGGCTGCGGGCTCTGCAGCCCTTC
CAGGTGGGGGACTTGCTGTTCTCCTGCCCGGCCTATGCCTACGTGCTCACGGTCAACGAG
CGGGGCAACCACTGCGAGTACTGCTTCACCAGGAAAGAAGGATTGTCCAAATGTGGAAGA
TGCAAGCAGGCATTTTACTGCAATGTGGAGTGTCAGAAAGAAGATTGGCCCATGCACAAG
CTGGAATGTTCTCCCATGGTTGTTTTTGGGGAAAACTGGAATCCCTCGGAGACTGTAAGA
CTAACAGCAAGGATTCTGGCCAAACAGAAAATCCACCCAGAGAGAACACCTTCGGAAAAA
TTGTTAGCTGTGAAGGAGTTTGAATCACATCTGGATAAGTTAGACAATGAGAAGAAGGAT
TTGATTCAGAGTGACATAGCTGCTCTCCATCACTTTTACTCCAAGCATCTCGGATTCCCT
GACAATGATAGCCTCGTAGTACTCTTTGCACAGGTTAACTGTAATGGCTTCACAATTGAA
GATGAAGAACTTTCTCATTTGGGATCAGCGATATTTCCTGATGTTGCATTGATGAATCAT
AGCTGTTGCCCCAATGTCATTGTGACCTACAAAGGGACCCTGGCAGAAGTCAGAGCTGTA
CAGGAAATCAAGCCGGGAGAGGAGGTTTTTACCAGCTATATTGATCTCCTGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15Avi6HT_NESG

pET15Avi6HT_NESG in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression vector with T7 lac promoter, N-terminal TEV-cleavable Avi-tag and 6XHis-tag; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: None
Size (bp): 5789
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Rutgers University
Gaetano T. Montleione
Thomas B. Acton
Stephen Anderson
Northeast Structural Genomics Consortium
PSI:Biology
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3944 4626
promoter T7 T7 promoter 541 560
protease cleavage site TEV TEV protease cleavage site 387 404
repressor binding site lac operator Lac operator 519 541
repressor protein gene LacI Lac repressor 3344 3520
selectable marker AmpR ampicillin resistance 4724 5383
tag His N-terminal 6xHis tag 405 422
tag AviTag Avi Tag 423 466
trxn termination sequence T7 term T7 terminator 217 263

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome

Gene

 

Gene Symbol : SMYD2
Symbol Nomenclature : SMYD2
SYNONYM : HSKM-B; KMT3C; ZMYND14
Designation : N-lysine methyltransferase SMYD2|SET and MYND domain-containing protein 2|histone methyltransferase SMYD2|lysine N-methyltransferase 3C|zinc finger, MYND domain containing 14
Full Nomenclature : SET and MYND domain containing 2
GENEID : 56950
Locus Tag : RP11-176D17.2
HGNC : 20982
MIM : 610663
Vega : OTTHUMG00000037066
Target GenBank: None

 

Pathways

NCI : p53 pathway

Protein

Structural Annotation Wiki : HR6531B
UniProt : Q9NRG4
HPRD : 15406

Clone

Cloning Information : 678557

Experimental

TargetTrack - Experimental data : HR6531B

Organism


TAX_ID : 9606
Species Specific ID: 56950

Genome

Chromosome : 1
Map Location : 1q32.3
Ensembl : ENSG00000143499