DNASU Plasmid Repository • 480.965.5697 | Email

SUV420H1 (Homo sapiens) in pET15Avi6HT_NESG

TOP

Explanation of Terms


Gene: Gene Symbol:  SUV420H1
Gene Name:  suppressor of variegation 4-20 homolog 1 (Drosophila)
Sequence             
Original Clone ID: None
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15Avi6HT_NESG               Format:  CLOSED
Source: Rutgers University
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Stephen Anderson
Elliot Campbell
Rutgers University
Protein Capture Reagents Program
HsCD00651953

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 351nts        
Open reading frame : 1 to 351

AGTGGATTTGAAATATTGCCATGTAATAGATACTCATCAGAACAAAATGGAGCCAAAATA
GTTGCAACAAAAGAGTGGAAACGAAATGACAAAATAGAATTACTGGTGGGTTGTATTGCC
GAACTTTCAGAAATTGAGGAGAACATGCTACTTAGACATGGAGAAAACGACTTCAGTGTC
ATGTACTCCACAAGGAAAAACTGTGCTCAACTCTGGCTGGGTCCTGCTGCGTTTATAAAC
CATGATTGCAGACCTAATTGTAAGTTTGTGTCAACTGGTCGAGATACAGCATGTGTGAAG
GCTCTAAGAGACATTGAACCTGGAGAAGAAATTTCTTGTTATTATGGATGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15Avi6HT_NESG

pET15Avi6HT_NESG in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression vector with T7 lac promoter, N-terminal TEV-cleavable Avi-tag and 6XHis-tag; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: None
Size (bp): 5789
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Rutgers University
Gaetano T. Montleione
Thomas B. Acton
Stephen Anderson
Northeast Structural Genomics Consortium
PSI:Biology
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3944 4626
promoter T7 T7 promoter 541 560
protease cleavage site TEV TEV protease cleavage site 387 404
repressor binding site lac operator Lac operator 519 541
repressor protein gene LacI Lac repressor 3344 3520
selectable marker AmpR ampicillin resistance 4724 5383
tag His N-terminal 6xHis tag 405 422
tag AviTag Avi Tag 423 466
trxn termination sequence T7 term T7 terminator 217 263

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome

Gene

 

Gene Symbol : SUV420H1
Symbol Nomenclature : SUV420H1
SYNONYM : CGI85; KMT5B
Designation : C630029K18Rik|histone-lysine N-methyltransferase SUV420H1|lysine N-methyltransferase 5B|su(var)4-20 homolog 1|suv4-20h1
Full Nomenclature : suppressor of variegation 4-20 homolog 1 (Drosophila)
GENEID : 51111
Locus Tag : CGI-85
HGNC : 24283
MIM : 610881
Vega : OTTHUMG00000150484
Target GenBank: None

 

Pathways

NCI : Glucocorticoid receptor regulatory network

Protein

Structural Annotation Wiki : HR8465A
UniProt : Q4FZB7
HPRD : 11616

Clone

Cloning Information : 678562

Experimental

TargetTrack - Experimental data : HR8465A

Organism


TAX_ID : 9606
Species Specific ID: 51111

Genome

Chromosome : 11
Map Location : 11q13.2
Ensembl : ENSG00000110066