DNASU Plasmid Repository • 480.965.5697 | Email

RAN (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RAN
Gene Name:  RAN, member RAS oncogene family
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH008465.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000658

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 651nts         Open reading frame : 1 to 651
Reference Sequence Alignment

ATGGCTGCGCAGGGAGAGCCCCAGGTCCAGTTCAAACTTGTATTGGTTGGTGATGGTGGT
ACTGGAAAAACGACCTTCGTGAAACGTCATTTGACTGGTGAATTTGAGAAGAAGTATGTA
GCCACCTTGGGTGTTGAGGTTCATCCCCTAGTGTTCCACACCAACAGAGGACCTATTAAG
TTCAATGTATGGGACACAGCCGGCCAGGAGAAATTCGGTGGACTGAGAGATGGCTATTAT
ATCCAAGCCCAGTGTGCCATCATAATGTTTGATGTAACATCGAGAGTTACTTACAAGAAT
GTGCCTAACTGGCATAGAGATCTGGTACGAGTGTGTGAAAACATCCCCATTGTGTTGTGT
GGCAACAAAGTGGATATTAAGGACAGGAAAGTGAAGGCGAAATCCATTGTCTTCCACCGA
AAGAAGAATCTTCAGTACTACGACATTTCTGCCAAAAGTAACTACAACTTTGAAGAGCCC
TTCCTCTGGCTTGCTAGGAAGCTCATTGGAGACCCTAACTTGGAATTTGTTGCCATGCCT
GCTCTCGCCCCACCAGAAGTTGTGATGGACCCAGCTTTGGCAGCACAGTATGAGCACGAC
TTAGAGGTTGCTCAGACAACTGCTCTCCCGGATGAGGATGATGACCTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 765
Start on reference sequence 115
Mutations:
None
Discrepancy:
a475g,K159E; c564g
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RAN
Symbol Nomenclature : RAN
SYNONYM : ARA24; Gsp1; TC4
Designation : GTP-binding nuclear protein Ran|GTPase Ran|OK/SW-cl.81|RanGTPase|androgen receptor-associated protein 24|guanosine triphosphatase Ran|member RAS oncogene family|ras-like protein TC4|ras-related nuclear protein
Full Nomenclature : RAN, member RAS oncogene family
GENEID : 5901
Locus Tag : OK/SW-cl.81
GI : 61366564
GenBank Accession : AY890940
HGNC : 9846
MIM : 601179
Target GenBank: NM_006325

 

Reference Sequence Alignment

  

HsCD00000658      ATGGCTGCGCAGGGAGAGCCCCAGGTCCAGTTCAAACTTGTATTGGTTGGTGATGGTGGT
NM_006325.3       ATGGCTGCGCAGGGAGAGCCCCAGGTCCAGTTCAAACTTGTATTGGTTGGTGATGGTGGT
                  ************************************************************

HsCD00000658      ACTGGAAAAACGACCTTCGTGAAACGTCATTTGACTGGTGAATTTGAGAAGAAGTATGTA
NM_006325.3       ACTGGAAAAACGACCTTCGTGAAACGTCATTTGACTGGTGAATTTGAGAAGAAGTATGTA
                  ************************************************************

HsCD00000658      GCCACCTTGGGTGTTGAGGTTCATCCCCTAGTGTTCCACACCAACAGAGGACCTATTAAG
NM_006325.3       GCCACCTTGGGTGTTGAGGTTCATCCCCTAGTGTTCCACACCAACAGAGGACCTATTAAG
                  ************************************************************

HsCD00000658      TTCAATGTATGGGACACAGCCGGCCAGGAGAAATTCGGTGGACTGAGAGATGGCTATTAT
NM_006325.3       TTCAATGTATGGGACACAGCCGGCCAGGAGAAATTCGGTGGACTGAGAGATGGCTATTAT
                  ************************************************************

HsCD00000658      ATCCAAGCCCAGTGTGCCATCATAATGTTTGATGTAACATCGAGAGTTACTTACAAGAAT
NM_006325.3       ATCCAAGCCCAGTGTGCCATCATAATGTTTGATGTAACATCGAGAGTTACTTACAAGAAT
                  ************************************************************

HsCD00000658      GTGCCTAACTGGCATAGAGATCTGGTACGAGTGTGTGAAAACATCCCCATTGTGTTGTGT
NM_006325.3       GTGCCTAACTGGCATAGAGATCTGGTACGAGTGTGTGAAAACATCCCCATTGTGTTGTGT
                  ************************************************************

HsCD00000658      GGCAACAAAGTGGATATTAAGGACAGGAAAGTGAAGGCGAAATCCATTGTCTTCCACCGA
NM_006325.3       GGCAACAAAGTGGATATTAAGGACAGGAAAGTGAAGGCGAAATCCATTGTCTTCCACCGA
                  ************************************************************

HsCD00000658      AAGAAGAATCTTCAGTACTACGACATTTCTGCCAAAAGTAACTACAACTTTGAAGAGCCC
NM_006325.3       AAGAAGAATCTTCAGTACTACGACATTTCTGCCAAAAGTAACTACAACTTTGAAAAGCCC
                  ******************************************************.*****

HsCD00000658      TTCCTCTGGCTTGCTAGGAAGCTCATTGGAGACCCTAACTTGGAATTTGTTGCCATGCCT
NM_006325.3       TTCCTCTGGCTTGCTAGGAAGCTCATTGGAGACCCTAACTTGGAATTTGTTGCCATGCCT
                  ************************************************************

HsCD00000658      GCTCTCGCCCCACCAGAAGTTGTGATGGACCCAGCTTTGGCAGCACAGTATGAGCACGAC
NM_006325.3       GCTCTCGCCCCACCAGAAGTTGTCATGGACCCAGCTTTGGCAGCACAGTATGAGCACGAC
                  *********************** ************************************

HsCD00000658      TTAGAGGTTGCTCAGACAACTGCTCTCCCGGATGAGGATGATGACCTGTTG
NM_006325.3       TTAGAGGTTGCTCAGACAACTGCTCTCCCGGATGAGGATGATGACCTGTGA
                  ************************************************* .

Pathways

NCI : Aurora A signaling
NCI : Canonical NF-kappaB pathway
NCI : FoxO family signaling
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Signaling events mediated by HDAC Class I
NCI : Signaling events mediated by HDAC Class II
NCI : Sumoylation by RanBP2 regulates transcriptional repression
Reactome : Disease
Reactome : Export of Viral Ribonucleoproteins from Nucleus
Reactome : Gene Expression
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : Host Interactions of HIV factors
Reactome : Influenza Infection
Reactome : Influenza Life Cycle
Reactome : Interactions of Rev with host cellular proteins
Reactome : Late Phase of HIV Life Cycle
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : MicroRNA (miRNA) biogenesis
Reactome : NEP/NS2 Interacts with the Cellular Export Machinery
Reactome : Nuclear import of Rev protein
Reactome : Regulation of cholesterol biosynthesis by SREBP (SREBF)
Reactome : Regulatory RNA pathways
Reactome : Rev-mediated nuclear export of HIV RNA
WikiPathway : Androgen receptor signaling pathway

Clone

Cloning Information : 8465
HIP Master Clone ID : 10960
Original Clone ID : FLH008465.01L

Organism


TAX_ID : 9606
Species Specific ID: 5901

Genome

Chromosome : 12
Map Location : 12q24.3

Reagents

Labome : Ran-antibody