DNASU Plasmid Repository • 480.965.5697 | Email

BRCA1 (Homo sapiens) in pET21_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BRCA1
Gene Name:  breast cancer 1, early onset
Sequence             
Original Clone ID: HR4800E-1224-1439-21.3
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET21_NESG               Format:  FUSION
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Northeast Structural Genomics Consortium
Rutgers University
PSI:Biology
HsCD00662812

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 651nts         Open reading frame : 1 to 651

ATGCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACT
AGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAGAGGAGAATTTATTATCA
TTGAAGAATAGCTTAAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAA
CATCACCTTAGTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAA
TTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAA
CAAATGAGGCATCAGTCTGAAAGCCAGGGAGTTGGTCTGAGTGACAAGGAATTGGTTTCA
GATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAAGAAGAGCAAAGCATGGAT
TCAAACTTAGGTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGC
TCAGGGCTATCCTCTCAGAGTGACATTTTAACCACTCAGCAGAGGGATACCATGCAACAT
AACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAGCATGGG
AGCCAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GGAGATATACAT

3' Linker Sequence:
CTCGAGCACCACCACCACCACCACTGA

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in HR4800E
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET21_NESG

pET21_NESG in advanced viewed

Synonyms: pET21, pET21-modified, pET21Cc, pET21_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds C-terminal 6xHis tag; ampicillin resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5415
Parent Vector: None
Empty Vector: EvNO00336944
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Thomas B. Acton
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, BamHI, EcoRI, XhoI) 157 253
bacterial origin ori pBR322-type bacterial origin of replication 3180 3862
gene fragment ROP ROP 2580 2756
primer T7 forward T7 forward sequencing primer 283 298
primer T7 reverse T7 reverse sequencing primer 66 84
promoter T7 T7 promoter 280 299
repressor binding site lacO lacO regulatory sequence 258 280
repressor protein gene LacI LacI 752 1768
selectable marker AmpR ampicillin resistance gene 3960 4619
ssDNA origin f1 ori f1 origin 5081 5387
tag His C-terminal 6xHis tag 140 157
trxn termination sequence T7 term T7 termination sequence 68 72

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome

Gene

 

Gene Symbol : BRCA1
Symbol Nomenclature : BRCA1
SYNONYM : BRCAI; BRCC1; BROVCA1; IRIS; PNCA4; PPP1R53; PSCP; RNF53
Designation : BRCA1/BRCA2-containing complex, subunit 1|RING finger protein 53|breast and ovarian cancer susceptibility protein 1|breast and ovarian cancer sususceptibility protein 1|breast cancer type 1 susceptibility protein|protein phosphatase 1, regulatory subunit 53
Full Nomenclature : breast cancer 1, early onset
GENEID : 672
GenBank Accession : NM_007306
HGNC : 1100
MIM : 113705
Vega : OTTHUMG00000157426
Target GenBank: None

 

Pathways

NCI : ATF-2 transcription factor network
NCI : ATM pathway
NCI : Aurora A signaling
NCI : BARD1 signaling events
NCI : Coregulation of Androgen receptor activity
NCI : E2F transcription factor network
NCI : FOXA1 transcription factor network
NCI : Fanconi anemia pathway
NCI : Validated nuclear estrogen receptor alpha network
NCI : Validated targets of C-MYC transcriptional repression
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : Cell Cycle
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Fanconi Anemia pathway
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Meiotic synapsis
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
WikiPathway : Androgen receptor signaling pathway
WikiPathway : DNA damage response
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : miRNA regulation of DNA Damage Response

Protein

Structural Annotation Wiki : HR4800E
UniProt : P38398
HPRD : 00218

Clone

Cloning Information : 684352
Original Clone ID : HR4800E-1224-1439-21.3

Experimental

TargetTrack - Experimental data : HR4800E

Organism


TAX_ID : 9606
Species Specific ID: 672

Genome

Chromosome : 17
Map Location : 17q21
Ensembl : ENSG00000012048