DNASU Plasmid Repository • 480.965.5697 | Email

HIF1A (Homo sapiens) in pET15Nano6HT_NESG

TOP

Explanation of Terms


Gene: Gene Symbol:  HIF1A
Gene Name:  hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Sequence             
Original Clone ID: HR3603B-775-826-TEV.1
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15Nano6HT_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Northeast Structural Genomics Consortium
Rutgers University
PSI:Biology
HsCD00664767

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 159nts         Open reading frame : 10 to 168

AGCCATATGCCCTCTGATTTAGCATGTAGACTGCTGGGGCAATCAATGGATGAAAGTGGA
TTACCACAGCTGACCAGTTATGATTGTGAAGTTAATGCTCCTATACAAGGCAGCAGAAAC
CTACTGCAGGGTGAAGAATTACTCAGAGCTTTGGATCAAGTTAACTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGACGTTGAAGCTTGGCTGGACGAACGTGTTCCGCTGGTTGAAACCCA
TCACCATCACCATCACGAAAACCTGTATTTTCAGAGCCATATG

3' Linker Sequence:
CTCGAGATCCGG

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in HR3603B
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15Nano6HT_NESG

pET15Nano6HT_NESG in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression withT7 lac promoter, N-terminal Nano-tag, 6XHis-tag, TEV-cleavable; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: None
Size (bp): 5783
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Rutgers University
Gaetano T. Montleione
Thomas B. Acton
PSI:Biology
Stephen Anderson
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3938 4620
promoter T7 T7 promoter 535 554
protease cleavage site TEV TEV protease cleavage site 384 401
repressor binding site lac operator lac operator 513 535
repressor protein gene LacI LacI repressor 944 2023
selectable marker AmpR Ampicillin resistance 4718 5377
tag His N-terminal 6xHis tag 402 419
tag Nano N-termianl streptavidin-binding Nano tag 420 464

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome

Gene

 

Gene Symbol : HIF1A
Symbol Nomenclature : HIF1A
SYNONYM : HIF-1A; HIF-1alpha; HIF1; HIF1-ALPHA; MOP1; PASD8; bHLHe78
Designation : ARNT interacting protein|ARNT-interacting protein|HIF-1-alpha|PAS domain-containing protein 8|basic-helix-loop-helix-PAS protein MOP1|class E basic helix-loop-helix protein 78|hypoxia-inducible factor 1 alpha isoform I.3|hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)|hypoxia-inducible factor 1-alpha|hypoxia-inducible factor1alpha|member of PAS protein 1|member of PAS superfamily 1
Full Nomenclature : hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
GENEID : 3091
GI : 31077211
GenBank Accession : NM_181054
HGNC : 4910
MIM : 603348
Vega : OTTHUMG00000140344
Target GenBank: None

 

Pathways

NCI : AP-1 transcription factor network
NCI : HIF-1-alpha transcription factor network
NCI : Hypoxic and oxygen homeostasis regulation of HIF-1-alpha
NCI : Notch-mediated HES/HEY network
NCI : VEGFR1 specific signals
Panther : Angiogenesis
Panther : Hypoxia response via HIF activation
Panther : VEGF signaling pathway
Reactome : Cellular response to hypoxia
Reactome : Cellular responses to stress
Reactome : Circadian Clock
Reactome : Disease
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : NOTCH1 Intracellular Domain Regulates Transcription
Reactome : Oxygen-dependent asparagine hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Oxygen-dependent proline hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Regulation of Hypoxia-inducible Factor (HIF) by oxygen
Reactome : Regulation of gene expression by Hypoxia-inducible Factor
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
WikiPathway : Adipogenesis
WikiPathway : Angiogenesis
WikiPathway : Notch Signaling Pathway

Protein

Structural Annotation Wiki : HR3603B
UniProt : Q16665
HPRD : 04517

Clone

Cloning Information : 685548
Original Clone ID : HR3603B-775-826-TEV.1

Experimental

TargetTrack - Experimental data : HR3603B

Organism


TAX_ID : 9606
Species Specific ID: 3091

Genome

Chromosome : 14
Map Location : 14q23.2
Ensembl : ENSG00000100644