DNASU Plasmid Repository • 480.965.5697 | Email

RPA2 (Homo sapiens) in pET15Nano6HT_NESG

TOP

Explanation of Terms


Gene: Gene Symbol:  RPA2
Gene Name:  replication protein A2, 32kDa
Sequence             
Original Clone ID: HR7255A-172-270-TEV.6
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15Nano6HT_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Northeast Structural Genomics Consortium
Rutgers University
PSI:Biology
HsCD00664984

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 300nts         Open reading frame : 10 to 309

AGCCATATGGCCAACAGCCAGCCCTCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATG
AGTGAAGCAGGGAACTTTGGTGGGAATAGCTTCATGCCAGCAAATGGCCTCACTGTGGCC
CAAAACCAGGTGTTGAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGAACTTTCAG
GATCTCAAGAACCAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTT
CTGAGCAATGAGGGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGAT
GCAGAATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGACGTTGAAGCTTGGCTGGACGAACGTGTTCCGCTGGTTGAAACCCA
TCACCATCACCATCACGAAAACCTGTATTTTCAGAGCCATATG

3' Linker Sequence:
CTCGAGATCCGG

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Tested_Not_Found
ProteinPurified: Not_Tested
SolubleProtein: Not_Tested
Find experimental protocols in HR7255A
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15Nano6HT_NESG

pET15Nano6HT_NESG in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression withT7 lac promoter, N-terminal Nano-tag, 6XHis-tag, TEV-cleavable; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: None
Size (bp): 5783
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Rutgers University
Gaetano T. Montleione
Thomas B. Acton
PSI:Biology
Stephen Anderson
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3938 4620
promoter T7 T7 promoter 535 554
protease cleavage site TEV TEV protease cleavage site 384 401
repressor binding site lac operator lac operator 513 535
repressor protein gene LacI LacI repressor 944 2023
selectable marker AmpR Ampicillin resistance 4718 5377
tag His N-terminal 6xHis tag 402 419
tag Nano N-termianl streptavidin-binding Nano tag 420 464

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome

Gene

 

Gene Symbol : RPA2
Symbol Nomenclature : RPA2
SYNONYM : REPA2; RPA32
Designation : RF-A protein 2|RP-A p32|RP-A p34|replication factor A protein 2|replication protein A 32 kDa subunit|replication protein A 34 kDa subunit
Full Nomenclature : replication protein A2, 32kDa
GENEID : 6118
Locus Tag : RP4-547C9.3
GI : 4506585
GenBank Accession : NM_002946
HGNC : 10290
MIM : 179836
Vega : OTTHUMG00000003915
Target GenBank: None

 

Pathways

NCI : ATR signaling pathway
NCI : Fanconi anemia pathway
Panther : DNA replication
Reactome : Activation of ATR in response to replication stress
Reactome : Activation of the pre-replicative complex
Reactome : Assembly of the RAD51-ssDNA nucleoprotein complex
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : DNA strand elongation
Reactome : Double-Strand Break Repair
Reactome : Dual incision reaction in GG-NER
Reactome : Extension of Telomeres
Reactome : Formation of incision complex in GG-NER
Reactome : G1/S Transition
Reactome : G2/M Checkpoints
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : HSF1 activation
Reactome : Homologous DNA pairing and strand exchange
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Lagging Strand Synthesis
Reactome : M/G1 Transition
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Nucleotide Excision Repair
Reactome : Presynaptic phase of homologous DNA pairing and strand exchange
Reactome : Processing of DNA double-strand break ends
Reactome : Processive synthesis on the C-strand of the telomere
Reactome : Processive synthesis on the lagging strand
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Removal of the Flap Intermediate
Reactome : Removal of the Flap Intermediate from the C-strand
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)
WikiPathway : DNA Replication
WikiPathway : DNA damage response
WikiPathway : G1 to S cell cycle control
WikiPathway : miRNA regulation of DNA Damage Response

Protein

Structural Annotation Wiki : HR7255A
UniProt : P15927
HPRD : 01566

Clone

Cloning Information : 686040
Original Clone ID : HR7255A-172-270-TEV.6

Experimental

TargetTrack - Experimental data : HR7255A

Organism


TAX_ID : 9606
Species Specific ID: 6118

Genome

Chromosome : 1
Map Location : 1p35
Ensembl : ENSG00000117748