DNASU Plasmid Repository • 480.965.5697 | Email

IRF3 (Homo sapiens) in pET15Nano6HT_NESG

TOP

Explanation of Terms


Gene: Gene Symbol:  IRF3
Gene Name:  interferon regulatory factor 3
Sequence             
Original Clone ID: HR7278A-1-113-TEV.4
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15Nano6HT_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Northeast Structural Genomics Consortium
Rutgers University
PSI:Biology
HsCD00664986

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 342nts         Open reading frame : 7 to 348

AGCCATATGGGAACCCCAAAGCCACGGATCCTGCCCTGGCTGGTGTCGCAGCTGGACCTG
GGGCAACTGGAGGGCGTGGCCTGGGTGAACAAGAGCCGCACGCGCTTCCGCATCCCTTGG
AAGCACGGCCTACGGCAGGATGCACAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCC
GAGGCCACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGG
AATTTCCGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAG
GACCCTCACGACCCACATAAAATCTACGAGTTTGTGAACTCAGGATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGACGTTGAAGCTTGGCTGGACGAACGTGTTCCGCTGGTTGAAACCCA
TCACCATCACCATCACGAAAACCTGTATTTTCAGAGCCAT

3' Linker Sequence:
CTCGAGATCCGG

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in HR7278A
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15Nano6HT_NESG

pET15Nano6HT_NESG in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression withT7 lac promoter, N-terminal Nano-tag, 6XHis-tag, TEV-cleavable; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: None
Size (bp): 5783
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Rutgers University
Gaetano T. Montleione
Thomas B. Acton
PSI:Biology
Stephen Anderson
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3938 4620
promoter T7 T7 promoter 535 554
protease cleavage site TEV TEV protease cleavage site 384 401
repressor binding site lac operator lac operator 513 535
repressor protein gene LacI LacI repressor 944 2023
selectable marker AmpR Ampicillin resistance 4718 5377
tag His N-terminal 6xHis tag 402 419
tag Nano N-termianl streptavidin-binding Nano tag 420 464

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome

Gene

 

Gene Symbol : IRF3
Symbol Nomenclature : IRF3
Full Nomenclature : interferon regulatory factor 3
GENEID : 3661
GenBank Accession : NR_045568
HGNC : 6118
MIM : 603734
Vega : OTTHUMG00000183287
Target GenBank: None

 

Pathways

Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Activation of IRF3/IRF7 mediated by TBK1/IKK epsilon
Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Cytokine Signaling in Immune system
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : Hemostasis
Reactome : IRF3 mediated activation of type 1 IFN
Reactome : IRF3-mediated induction of type I IFN
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : LRR FLII-interacting protein 1 (LRRFIP1) activates type I IFN production
Reactome : MyD88-independent cascade
Reactome : Negative regulators of RIG-I/MDA5 signaling
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulation of innate immune responses to cytosolic DNA
Reactome : STING mediated induction of host immune responses
Reactome : TRAF3-dependent IRF activation pathway
Reactome : TRAF6 mediated IRF7 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : ZBP1(DAI) mediated induction of type I IFNs
WikiPathway : Apoptosis
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

Structural Annotation Wiki : HR7278A
UniProt : Q14653
HPRD : 04769

Clone

Cloning Information : 686045
Original Clone ID : HR7278A-1-113-TEV.4

Experimental

TargetTrack - Experimental data : HR7278A

Organism


TAX_ID : 9606
Species Specific ID: 3661

Genome

Chromosome : 19
Map Location : 19q13.3-q13.4
Ensembl : ENSG00000126456