DNASU Plasmid Repository • 480.965.5697 | Email

EPAS1 (Homo sapiens) in pET15Nano6HT_NESG

TOP

Explanation of Terms


Gene: Gene Symbol:  EPAS1
Gene Name:  endothelial PAS domain protein 1
Sequence             
Original Clone ID: HR8188A-239-350-TEV.5
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15Nano6HT_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Northeast Structural Genomics Consortium
Rutgers University
PSI:Biology
HsCD00665206

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 339nts         Open reading frame : 10 to 348

AGCCATATGCTGGATAGCAAGACCTTCCTGAGCCGCCACAGCATGGACATGAAGTTCACC
TACTGTGATGACAGAATCACAGAACTGATTGGTTACCACCCTGAGGAGCTGCTTGGCCGC
TCAGCCTATGAATTCTACCATGCGCTAGACTCCGAGAACATGACCAAGAGTCACCAGAAC
TTGTGCACCAAGGGTCAGGTAGTAAGTGGCCAGTACCGGATGCTCGCAAAGCATGGGGGC
TACGTGTGGCTGGAGACCCAGGGGACGGTCATCTACAACCCTCGCAACCTGCAGCCCCAG
TGCATCATGTGTGTCAACTACGTCCTGAGTGAGATTGAGAAGAATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGACGTTGAAGCTTGGCTGGACGAACGTGTTCCGCTGGTTGAAACCCA
TCACCATCACCATCACGAAAACCTGTATTTTCAGAGCCATATG

3' Linker Sequence:
CTCGAGATCCGG

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in HR8188A
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15Nano6HT_NESG

pET15Nano6HT_NESG in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression withT7 lac promoter, N-terminal Nano-tag, 6XHis-tag, TEV-cleavable; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: None
Size (bp): 5783
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Rutgers University
Gaetano T. Montleione
Thomas B. Acton
PSI:Biology
Stephen Anderson
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3938 4620
promoter T7 T7 promoter 535 554
protease cleavage site TEV TEV protease cleavage site 384 401
repressor binding site lac operator lac operator 513 535
repressor protein gene LacI LacI repressor 944 2023
selectable marker AmpR Ampicillin resistance 4718 5377
tag His N-terminal 6xHis tag 402 419
tag Nano N-termianl streptavidin-binding Nano tag 420 464

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome

Gene

 

Gene Symbol : EPAS1
Symbol Nomenclature : EPAS1
SYNONYM : ECYT4; HIF2A; HLF; MOP2; PASD2; bHLHe73
Designation : EPAS-1|HIF-1-alpha-like factor|HIF-1alpha-like factor|HIF-2-alpha|HIF2-alpha|PAS domain-containing protein 2|basic-helix-loop-helix-PAS protein MOP2|class E basic helix-loop-helix protein 73|endothelial PAS domain-containing protein 1|hypoxia-inducible factor 2 alpha|hypoxia-inducible factor 2-alpha|member of PAS protein 2
Full Nomenclature : endothelial PAS domain protein 1
GENEID : 2034
GI : 40254439
GenBank Accession : NM_001430
HGNC : 3374
MIM : 603349
Vega : OTTHUMG00000128818
Target GenBank: None

 

Pathways

NCI : HIF-2-alpha transcription factor network
Reactome : Cellular response to hypoxia
Reactome : Cellular responses to stress
Reactome : Developmental Biology
Reactome : Oxygen-dependent asparagine hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Oxygen-dependent proline hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Regulation of Hypoxia-inducible Factor (HIF) by oxygen
Reactome : Regulation of gene expression by Hypoxia-inducible Factor
Reactome : Transcriptional regulation of pluripotent stem cells
WikiPathway : Adipogenesis

Protein

Structural Annotation Wiki : HR8188A
UniProt : Q99814
HPRD : 06787

Clone

Cloning Information : 686106
Original Clone ID : HR8188A-239-350-TEV.5

Experimental

TargetTrack - Experimental data : HR8188A

Organism


TAX_ID : 9606
Species Specific ID: 2034

Genome

Chromosome : 2
Map Location : 2p21-p16
Ensembl : ENSG00000116016