DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pET15_8HMbpTEV_NESG

TOP

Explanation of Terms


Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pET15_8HMbpTEV_NESG              
Source: Northeast Structural Genomics Consortium
Description: Bacterial expression vector that increases protein solubility with T7 promoter with TEV-cleavable, 3C-cleavable N-temrinal 8xHis MBP tag; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: None
Publications: None
Authors: Northeast Structural Genomics Consortium
Rutgers University
Gaetano T. Montleione
Thomas B. Acton
PSI:Biology
Huang Wang
EvNO00665443

Price:  Login for Pricing
AVAILABLE
Academic and non-profit labs
Special MTA: PSI/NESG

 

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_8HMbpTEV_NESG

pET15_8HMbpTEV_NESG in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  MBPSeq Forward
Reverse:  T7 terminator
Description: Bacterial expression vector that increases protein solubility with T7 promoter with TEV-cleavable, 3C-cleavable N-temrinal 8xHis MBP tag; ampicillin resistance in bacteria; restriction enzyme cloning
Comments: None
Size (bp): 6868
Parent Vector: None
Properties: bacterial expression, improves solubility of insert, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Rutgers University
Gaetano T. Montleione
Thomas B. Acton
PSI:Biology
Huang Wang
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin 1004 1686
primer MBP forward MBPSeq Forward sequencing primer TCGTCAGACTGTCGATGAAG 6251 6270
promoter T7 T7 promoter 5070 5089
protease cleavage site 3C 3C protease cleavage site 6314 6338
protease cleavage site TEV TEV protease cleavage site 6339 6359
repressor binding site lac operator Lac operator 5089 5111
repressor protein gene LacI LacI 3601 4680
selectable marker AmpR ampicillin resistance 247 906
tag MBP N-terminal 8xHisMBP tag 5193 6289
tag His N-terminal 8xHis MBP tag 5163 5186
trxn termination sequence T7 term T7 transcriptional terminator 6477 6523

 

Species Specific ID: None
Target GenBank: None