QSCN6 (Homo sapiens) in P2RP3

Explanation of Terms

Gene Symbol:  QSCN6
Gene Name:  quiescin Q6 sulfhydryl oxidase 1
Original Clone ID:
Sequence Verified: Yes; 3'UTR length: 1177; Forward Primer: TGGCCACCCTGCAGCCTG; Reverse Primer: CAGACAGTTCTATGGGCAGTCTGT
Homo sapiens
Vector Name:
Center for Personalized Diagnostics
Please cite: Kotagama, K., Babb, C.S., Wolter, J.M., Murphy, R.P. and Mangone, M. "A human 3'UTR clone collection to study post-transcriptional gene regulation". BMC Genomics 16, 1036 (2015).
Mutation / Discrepancy:
No / No
PMID: 26645212
Title: A human 3'UTR clone collection to study post-transcriptional gene regulation
Center for Personalized Diagnostics
Marco Mangone
Kasuen Kotagama
Login for Pricing
No restriction
Special MTA: None
Insert sequence: 1176nts
Open reading frame: 1 to 1176


Protein sequence predicted based on nucleotide sequence


Coding Sequence Details

Insert Sequence Verified?:
Verification Method:
Sequence Verification
5' Linker Sequence:
3' Linker Sequence:

Recommended Growth Condition:

Distributed in bacterial strain:
DH5-alpha T1 phage resistant
Antibiotic Selection:
Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition: kanamycin
Growth Condition: Growth in 50 ug/ml of kanamycin in LB at 37 degrees
Comments: None
Protein Expression Results:
Recommended expression in:
Not Applicable