DNASU Plasmid Repository • 480.965.5697 | Email

CAMTA1 (Homo sapiens) in P2RP3

TOP

Explanation of Terms


Gene: Gene Symbol:  CAMTA1
Gene Name:  calmodulin binding transcription activator 1
Sequence             
Original Clone ID: None
Keyword: Sequence Verified: Yes; 3'UTR length: 656; Forward Primer: TGGAGCCATGAGGGCTGA; Reverse Primer: CCCTGAACTAGGCTTCCAGTTACTTCA
Species: Homo sapiens
Type: 3'UTR
Vector Name: P2RP3               Format:  None
Source: Center for Personalized Diagnostics
Description: Please cite: Kotagama, K., Babb, C.S., Wolter, J.M., Murphy, R.P. and Mangone, M. "A human 3'UTR clone collection to study post-transcriptional gene regulation". BMC Genomics 16, 1036 (2015).
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 26645212
Title: A human 3'UTR clone collection to study post-transcriptional gene regulation
Authors: Center for Personalized Diagnostics
Marco Mangone
Kasuen Kotagama
HsUT00699103

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 657nts         Open reading frame : 1 to 657

GGATCCACAGAGCTGGAGCCATGAGGGCTGACACATTGGAATGAAAGCTGGCAGAATTCG
TAGGGAGAGCTTTCCCATCCTGCCAGCCCCATGTCTGGCTTTAAGACAGTTCTATTAGTG
AATTAACTGTTCTCAAAACCCCAAATTAATTTGAACCGAATGTTACTAAAAATGAAATAG
AATAAAGTGACCTACTCTTGCCTCATCCGGAGTTATTACGAAGGAGCTCCGCAGCCTGAC
TGAGCTCTGGAGAGCAGGGCTCTGTGCACACGCCTCCTGGTCCAGAGGCCTCCGTGACCA
TCCATGATGCCACTCTGTCCCCTCAGCAAGCTGCCTTTTTCTTCCTAGCACCTGCCCCAG
CGGTGGTATGTTTTCCAGTCAGTTACCACCTGTCTCATCAGAATGGAAGCTCCATGAGAG
CAGGGCCTTTGTCTTGTCCCCTTGTATCTTCAGTGCATAGGACAGTGCTGACACAGTGCA
GAGTCTAAATAAACGCTGTTGAACGAATGTGTGGGTCACTTGCGTCGCATCCTTTCTGAA
TGTTTTTCCTTTAACTTGCCATTTATAAATACCTTTTCCAATGATAAAGCAGTGAAAGTT
TGGAAAGAAGCATAAAGCTTTTGTTGTGATTGAAGTAACTGGAAGCCTAGTTCAGGG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  kanamycin
Growth Condition:  Growth in 50 ug/ml of kanamycin in LB at 37 degrees
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: P2RP3

P2RP3 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Features: ccdB Bacterial toxin (suicide gene) M13 reverse Primer binding site M13 Forward Primer binding site T7 Promoter CAT Promoter attP2 Recombination site attP3 Recombination site CmR Resistance Chloramphenicol (Selectable marker) KanR Resistance to Kanamycin (Selectable marker)
Comments: CPD only
Size (bp): 4773
Parent Vector: None
Empty Vector: None
Properties: Gateway, baculovirus/insect cell expression, baculovirus/insect cell transposition, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
death cassette ccdB Death Cassette 2084 2389
primer M13 reverse 3038 3054
primer M13 forward 537 553
promoter T7 3015 3033
promoter CAT 980 1082
recombination site attP2 591 822
recombination site attP3 2746 2977
selectable marker CmR Chloramphenicol resistance 1083 1742
selectable marker KanR 3167 3967

 

  • Gene
  • Clone
  • Organism

Gene

Target GenBank: NM_001242701

 

Clone

Cloning Information : 753919

Organism


Species Specific ID: 213