DNASU Plasmid Repository • 480.965.5697 | Email

RAP1B (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RAP1B
Gene Name:  RAP1B, member of RAS oncogene family
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH008340.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000705

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 555nts         Open reading frame : 1 to 555
Reference Sequence Alignment

ATGCGTGAGTATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAGTCTGCTTTGACT
GTACAATTTGTTCAAGGAATTTTTGTAGAAAAATACGATCCTACGATAGAAGATTCTTAT
AGAAAGCAAGTTGAAGTAGATGCACAACAGTGTATGCTTGAAATCTTGGATACTGCAGGA
ACGGAGCAATTTACAGCAATGAGGGATTTATACATGAAAAATGGACAAGGATTTGCATTA
GTTTATTCCATCACAGCACAGTCCACATTTAACGATTTACAAGACCTGAGAGAACAGATT
CTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTTGTTGGTAATAAGTGTGACTTG
GAAGATGAAAGAGTTGTAGGGAAGGAACAAGGTCAAAATCTAGCAAGACAATGGAACAAC
TGTGCATTCTTAGAATCTTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGAC
CTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCTCGCAAAAAGTCATCA
TGTCAGCTGCTTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 703
Start on reference sequence 149
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RAP1B
Symbol Nomenclature : RAP1B
SYNONYM : K-REV; RAL1B
Designation : GTP-binding protein smg p21B|RAS-related protein RAP1B|Ras family small GTP binding protein RAP1B|ras-related protein Rap-1b|small GTP binding protein
Full Nomenclature : RAP1B, member of RAS oncogene family
GENEID : 5908
Locus Tag : OK/SW-cl.11
GI : 61356940
GenBank Accession : AY888365
HGNC : 9857
MIM : 179530
Vega : OTTHUMG00000133660
Target GenBank: NM_015646

 

Reference Sequence Alignment

  

HsCD00000705        ATGCGTGAGTATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAGTCTGCTTTGACT
NM_015646.5         ATGCGTGAGTATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAGTCTGCTTTGACT
NM_001010942.2      ATGCGTGAGTATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAGTCTGCTTTGACT
NM_001010935.1      ATGCGTGAGTACAAGCTAGTGGTCCTTGGTTCAGGAGGCGTTGGGAAGTCTGCTCTGACA
NM_002884.2         ATGCGTGAGTACAAGCTAGTGGTCCTTGGTTCAGGAGGCGTTGGGAAGTCTGCTCTGACA
                    *********** ******** ** ***** **************.********* ****:

HsCD00000705        GTACAATTTGTTCAAGGAATTTTTGTAGAAAAATACGATCCTACGATAGAAGATTCTTAT
NM_015646.5         GTACAATTTGTTCAAGGAATTTTTGTAGAAAAATACGATCCTACGATAGAAGATTCTTAT
NM_001010942.2      GTACAATTTGTTCAAGGAATTTTTGTAGAAAAATACGATCCTACGATAGAAGATTCTTAT
NM_001010935.1      GTTCAGTTTGTTCAGGGAATTTTTGTTGAAAAATATGACCCAACGATAGAAGATTCCTAC
NM_002884.2         GTTCAGTTTGTTCAGGGAATTTTTGTTGAAAAATATGACCCAACGATAGAAGATTCCTAC
                    **:**.********.***********:******** ** **:************** ** 

HsCD00000705        AGAAAGCAAGTTGAAGTAGATGCACAACAGTGTATGCTTGAAATCTTGGATACTGCAGGA
NM_015646.5         AGAAAGCAAGTTGAAGTAGATGCACAACAGTGTATGCTTGAAATCTTGGATACTGCAGGA
NM_001010942.2      AGAAAGCAAGTTGAAGTAGATGCACAACAGTGTATGCTTGAAATCTTGGATACTGCAGGA
NM_001010935.1      AGAAAGCAAGTTGAAGTCGATTGCCAACAGTGTATGCTCGAAATCCTGGATACTGCAGGG
NM_002884.2         AGAAAGCAAGTTGAAGTCGATTGCCAACAGTGTATGCTCGAAATCCTGGATACTGCAGGG
                    *****************.***  .************** ****** *************.

HsCD00000705        ACGGAGCAATTTACAGCAATGAGGGATTTATACATGAAAAATGGACAAGGATTTGCATTA
NM_015646.5         ACGGAGCAATTTACAGCAATGAGGGATTTATACATGAAAAATGGACAAGGATTTGCATTA
NM_001010942.2      ACGGAGCAATTTACAGCAATGAGGGATTTATACATGAAAAATGGACAAGGATTTGCATTA
NM_001010935.1      ACAGAGCAATTTACAGCAATGAGGGATTTGTATATGAAGAACGGCCAAGGTTTTGCACTA
NM_002884.2         ACAGAGCAATTTACAGCAATGAGGGATTTGTATATGAAGAACGGCCAAGGTTTTGCACTA
                    **.**************************.** *****.** **.*****:****** **

HsCD00000705        GTTTATTCCATCACAGCACAGTCCACATTTAACGATTTACAAGACCTGAGAGAACAGATT
NM_015646.5         GTTTATTCCATCACAGCACAGTCCACATTTAACGATTTACAAGACCTGAGAGAACAGATT
NM_001010942.2      GTTTATTCCATCACAGCACAGTCCACATTTAACGATTTACAAGACCTGAGAGAACAGATT
NM_001010935.1      GTATATTCTATTACAGCTCAGTCCACGTTTAACGACTTACAGGACCTGAGGGAACAGATT
NM_002884.2         GTATATTCTATTACAGCTCAGTCCACGTTTAACGACTTACAGGACCTGAGGGAACAGATT
                    **:***** ** *****:********.******** *****.********.*********

HsCD00000705        CTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTTGTTGGTAATAAGTGTGACTTG
NM_015646.5         CTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTTGTTGGTAATAAGTGTGACTTG
NM_001010942.2      CTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTTGTTGGTAATAAGTGTGACTTG
NM_001010935.1      TTACGGGTTAAGGACACGGAAGATGTTCCAATGATTTTGGTTGGCAATAAATGTGACCTG
NM_002884.2         TTACGGGTTAAGGACACGGAAGATGTTCCAATGATTTTGGTTGGCAATAAATGTGACCTG
                     *:**.*****.***** **:*************** * ***** *****.****** **

HsCD00000705        GAAGATGAAAGAGTTGTAGGGAAGGAACAAGGTCAAAATCTAGCAAGACAATGGAACAAC
NM_015646.5         GAAGATGAAAGAGTTGTAGGGAAGGAACAAGGTCAAAATCTAGCAAGACAATGGAACAAC
NM_001010942.2      GAAGATGAAAGAGTTGTAGGGAAGGAACAAGGTCAAAATCTAGCAAGACAATGGAACAAC
NM_001010935.1      GAAGATGAGCGAGTAGTTGGCAAAGAGCAGGGCCAGAATTTAGCAAGACAGTGGTGTAAC
NM_002884.2         GAAGATGAGCGAGTAGTTGGCAAAGAGCAGGGCCAGAATTTAGCAAGACAGTGGTGTAAC
                    ********..****:**:** **.**.**.** **.*** **********.***:. ***

HsCD00000705        TGTGCATTCTTAGAATCTTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGAC
NM_015646.5         TGTGCATTCTTAGAATCTTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGAC
NM_001010942.2      TGTGCATTCTTAGAATCTTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGAC
NM_001010935.1      TGTGCCTTTTTAGAATCTTCTGCAAAGTCAAAGATCAATGTTAATGAGATATTTTATGAC
NM_002884.2         TGTGCCTTTTTAGAATCTTCTGCAAAGTCAAAGATCAATGTTAATGAGATATTTTATGAC
                    *****.** *****************.*****.**.**************.*********

HsCD00000705        CTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCTCGCAAAAAGTCATCA
NM_015646.5         CTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCTCGCAAAAAGTCATCA
NM_001010942.2      CTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCTCGCAAAAAGTCATCA
NM_001010935.1      CTGGTCAGACAGATAAATAGGAAAACACCAGTGGAAAAGAAGAAGCCTAAAAAGAAATCA
NM_002884.2         CTGGTCAGACAGATAAATAGGAAAACACCAGTGGAAAAGAAGAAGCCTAAAAAGAAATCA
                    **.** .*.**.**:** **.*****:****** .:..****.. *  ******:.****

HsCD00000705        TGTCAGCTGCTTTAG
NM_015646.5         TGTCAGCTGCTTTAA
NM_001010942.2      TGTCAGCTGCTTTAA
NM_001010935.1      TGTCTGCTGCTCTAG
NM_002884.2         TGTCTGCTGCTCTAG
                    ****:****** **.

Pathways

NCI : CXCR4-mediated signaling events
NCI : E-cadherin signaling in the nascent adherens junction
NCI : EPHB forward signaling
NCI : IFN-gamma pathway
NCI : Nectin adhesion pathway
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : PDGFR-beta signaling pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by focal adhesion kinase
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : amb2 Integrin signaling
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Panther : Integrin signalling pathway
Reactome : Adaptive Immune System
Reactome : GRB2:SOS provides linkage to MAPK signaling for Integrins
Reactome : Hemostasis
Reactome : Immune System
Reactome : Integrin alphaIIb beta3 signaling
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Rap1 signalling
Reactome : Signal Transduction
Reactome : p130Cas linkage to MAPK signaling for integrins
WikiPathway : Focal Adhesion
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : MAPK signaling pathway
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TSH signaling pathway

Clone

Cloning Information : 8340
HIP Master Clone ID : 10835
Original Clone ID : FLH008340.01X

Organism


TAX_ID : 9606
Species Specific ID: 5908

Genome

Chromosome : 12
Map Location : 12q14
Ensembl : ENSG00000127314

Reagents

Labome : RAP1B-antibody