DNASU Plasmid Repository • 480.965.5697 | Email

RAP1A (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RAP1A
Gene Name:  RAP1A, member of RAS oncogene family
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH008326.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000706

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 555nts         Open reading frame : 1 to 555
Reference Sequence Alignment

ATGCGTGAGTACAAGCTAGTGGTCCTTGGTTCAGGAGGCGTTGGGAAGTCTGCTCTGACA
GTTCAGTTTGTTCAGGGAATTTTTGTTGAAAAATATGACCCAACGATAGAAGATTCCTAC
AGAAAGCAAGTTGAAGTCGATTGCCAACAGTGTATGCTCGAAATCCTGGATACTGCAGGG
ACAGAGCAATTTACAGCAATGAGGGATTTGTATATGAAGAACGGCCAAGGTTTTGCACTA
GTATATTCTATTACAGCTCAGTCCACGTTTAACGACTTACAGGACCTGAGGGAACAGATT
TTACGGGTTAAGGACACGGAAGATGTTCCAATGATTTTGGTTGGCAATAAATGTGACCTG
GAAGATGAGCGAGTAGTTGGCAAAGAGCAGGGCCAGAATTTAGCAAGACAGTGGTGTAAC
TGTGCCCTTTTAGAATCTTCTGCAAAGTCAAAGATCAATGTTAATGAGATATTTTATGAC
CTGGTCAGACAGATAAATAGGAAAACACCAGTGGAAAAGAAGAAGCCTAAAAAGAAATCA
TGTCTGCTGCTCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 867
Start on reference sequence 313
Mutations:
None
Discrepancy:
t427c,F143L
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RAP1A
Symbol Nomenclature : RAP1A
SYNONYM : KREV-1; KREV1; RAP1; SMGP21
Designation : C21KG|G-22K|GTP-binding protein smg p21A|RAS-related protein RAP1A|Ras-related protein Krev-1|ras-related protein Rap-1A
Full Nomenclature : RAP1A, member of RAS oncogene family
GENEID : 5906
GI : 61356947
GenBank Accession : AY888366
HGNC : 9855
MIM : 179520
Target GenBank: NM_002884

 

Reference Sequence Alignment

  

HsCD00000706        ATGCGTGAGTACAAGCTAGTGGTCCTTGGTTCAGGAGGCGTTGGGAAGTCTGCTCTGACA
NM_015646.5         ATGCGTGAGTATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAGTCTGCTTTGACT
NM_001010942.2      ATGCGTGAGTATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAGTCTGCTTTGACT
NM_001010935.1      ATGCGTGAGTACAAGCTAGTGGTCCTTGGTTCAGGAGGCGTTGGGAAGTCTGCTCTGACA
NM_002884.2         ATGCGTGAGTACAAGCTAGTGGTCCTTGGTTCAGGAGGCGTTGGGAAGTCTGCTCTGACA
                    *********** ******** ** ***** **************.********* ****:

HsCD00000706        GTTCAGTTTGTTCAGGGAATTTTTGTTGAAAAATATGACCCAACGATAGAAGATTCCTAC
NM_015646.5         GTACAATTTGTTCAAGGAATTTTTGTAGAAAAATACGATCCTACGATAGAAGATTCTTAT
NM_001010942.2      GTACAATTTGTTCAAGGAATTTTTGTAGAAAAATACGATCCTACGATAGAAGATTCTTAT
NM_001010935.1      GTTCAGTTTGTTCAGGGAATTTTTGTTGAAAAATATGACCCAACGATAGAAGATTCCTAC
NM_002884.2         GTTCAGTTTGTTCAGGGAATTTTTGTTGAAAAATATGACCCAACGATAGAAGATTCCTAC
                    **:**.********.***********:******** ** **:************** ** 

HsCD00000706        AGAAAGCAAGTTGAAGTCGATTGCCAACAGTGTATGCTCGAAATCCTGGATACTGCAGGG
NM_015646.5         AGAAAGCAAGTTGAAGTAGATGCACAACAGTGTATGCTTGAAATCTTGGATACTGCAGGA
NM_001010942.2      AGAAAGCAAGTTGAAGTAGATGCACAACAGTGTATGCTTGAAATCTTGGATACTGCAGGA
NM_001010935.1      AGAAAGCAAGTTGAAGTCGATTGCCAACAGTGTATGCTCGAAATCCTGGATACTGCAGGG
NM_002884.2         AGAAAGCAAGTTGAAGTCGATTGCCAACAGTGTATGCTCGAAATCCTGGATACTGCAGGG
                    *****************.***  .************** ****** *************.

HsCD00000706        ACAGAGCAATTTACAGCAATGAGGGATTTGTATATGAAGAACGGCCAAGGTTTTGCACTA
NM_015646.5         ACGGAGCAATTTACAGCAATGAGGGATTTATACATGAAAAATGGACAAGGATTTGCATTA
NM_001010942.2      ACGGAGCAATTTACAGCAATGAGGGATTTATACATGAAAAATGGACAAGGATTTGCATTA
NM_001010935.1      ACAGAGCAATTTACAGCAATGAGGGATTTGTATATGAAGAACGGCCAAGGTTTTGCACTA
NM_002884.2         ACAGAGCAATTTACAGCAATGAGGGATTTGTATATGAAGAACGGCCAAGGTTTTGCACTA
                    **.**************************.** *****.** **.*****:****** **

HsCD00000706        GTATATTCTATTACAGCTCAGTCCACGTTTAACGACTTACAGGACCTGAGGGAACAGATT
NM_015646.5         GTTTATTCCATCACAGCACAGTCCACATTTAACGATTTACAAGACCTGAGAGAACAGATT
NM_001010942.2      GTTTATTCCATCACAGCACAGTCCACATTTAACGATTTACAAGACCTGAGAGAACAGATT
NM_001010935.1      GTATATTCTATTACAGCTCAGTCCACGTTTAACGACTTACAGGACCTGAGGGAACAGATT
NM_002884.2         GTATATTCTATTACAGCTCAGTCCACGTTTAACGACTTACAGGACCTGAGGGAACAGATT
                    **:***** ** *****:********.******** *****.********.*********

HsCD00000706        TTACGGGTTAAGGACACGGAAGATGTTCCAATGATTTTGGTTGGCAATAAATGTGACCTG
NM_015646.5         CTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTTGTTGGTAATAAGTGTGACTTG
NM_001010942.2      CTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTTGTTGGTAATAAGTGTGACTTG
NM_001010935.1      TTACGGGTTAAGGACACGGAAGATGTTCCAATGATTTTGGTTGGCAATAAATGTGACCTG
NM_002884.2         TTACGGGTTAAGGACACGGAAGATGTTCCAATGATTTTGGTTGGCAATAAATGTGACCTG
                     *:**.*****.***** **:*************** * ***** *****.****** **

HsCD00000706        GAAGATGAGCGAGTAGTTGGCAAAGAGCAGGGCCAGAATTTAGCAAGACAGTGGTGTAAC
NM_015646.5         GAAGATGAAAGAGTTGTAGGGAAGGAACAAGGTCAAAATCTAGCAAGACAATGGAACAAC
NM_001010942.2      GAAGATGAAAGAGTTGTAGGGAAGGAACAAGGTCAAAATCTAGCAAGACAATGGAACAAC
NM_001010935.1      GAAGATGAGCGAGTAGTTGGCAAAGAGCAGGGCCAGAATTTAGCAAGACAGTGGTGTAAC
NM_002884.2         GAAGATGAGCGAGTAGTTGGCAAAGAGCAGGGCCAGAATTTAGCAAGACAGTGGTGTAAC
                    ********..****:**:** **.**.**.** **.*** **********.***:. ***

HsCD00000706        TGTGCCCTTTTAGAATCTTCTGCAAAGTCAAAGATCAATGTTAATGAGATATTTTATGAC
NM_015646.5         TGTGCATTCTTAGAATCTTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGAC
NM_001010942.2      TGTGCATTCTTAGAATCTTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGAC
NM_001010935.1      TGTGCCTTTTTAGAATCTTCTGCAAAGTCAAAGATCAATGTTAATGAGATATTTTATGAC
NM_002884.2         TGTGCCTTTTTAGAATCTTCTGCAAAGTCAAAGATCAATGTTAATGAGATATTTTATGAC
                    *****. * *****************.*****.**.**************.*********

HsCD00000706        CTGGTCAGACAGATAAATAGGAAAACACCAGTGGAAAAGAAGAAGCCTAAAAAGAAATCA
NM_015646.5         CTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCTCGCAAAAAGTCATCA
NM_001010942.2      CTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCTCGCAAAAAGTCATCA
NM_001010935.1      CTGGTCAGACAGATAAATAGGAAAACACCAGTGGAAAAGAAGAAGCCTAAAAAGAAATCA
NM_002884.2         CTGGTCAGACAGATAAATAGGAAAACACCAGTGGAAAAGAAGAAGCCTAAAAAGAAATCA
                    **.** .*.**.**:** **.*****:****** .:..****.. *  ******:.****

HsCD00000706        TGTCTGCTGCTCTAG
NM_015646.5         TGTCAGCTGCTTTAA
NM_001010942.2      TGTCAGCTGCTTTAA
NM_001010935.1      TGTCTGCTGCTCTAG
NM_002884.2         TGTCTGCTGCTCTAG
                    ****:****** **.

Pathways

NCI : Class I PI3K signaling events
NCI : E-cadherin signaling in the nascent adherens junction
NCI : EPHB forward signaling
NCI : EPO signaling pathway
NCI : IFN-gamma pathway
NCI : Nectin adhesion pathway
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : PDGFR-beta signaling pathway
NCI : Reelin signaling pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : amb2 Integrin signaling
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Panther : Integrin signalling pathway
Reactome : ARMS-mediated activation
Reactome : Adaptive Immune System
Reactome : Frs2-mediated activation
Reactome : GRB2:SOS provides linkage to MAPK signaling for Integrins
Reactome : Glucagon-like Peptide-1 (GLP1) regulates insulin secretion
Reactome : Hemostasis
Reactome : Immune System
Reactome : Integration of energy metabolism
Reactome : Integrin alphaIIb beta3 signaling
Reactome : Metabolism
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Prolonged ERK activation events
Reactome : Rap1 signalling
Reactome : Regulation of insulin secretion
Reactome : Signal Transduction
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : p130Cas linkage to MAPK signaling for integrins
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Focal Adhesion
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : MAPK signaling pathway
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : Serotonin Receptor 4/6/7 and NR3C Signaling
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TSH signaling pathway

Clone

Cloning Information : 8326
HIP Master Clone ID : 10821
Original Clone ID : FLH008326.01X

Organism


TAX_ID : 9606
Species Specific ID: 5906

Genome

Chromosome : 1
Map Location : 1p13.3
Ensembl : ENSG00000116473

Reagents

Labome : Rap1-antibody