DNASU Plasmid Repository • 480.965.5697 | Email

ATF4 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ATF4
Gene Name:  activating transcription factor 4
Sequence             
Original Clone ID: FLH257630.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00073588

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1053nts         Open reading frame : 1 to 1053
Reference Sequence Alignment

ATGACCGAAATGAGCTTCCTGAGCAGCGAGGTGTTGGTGGGGGACTTGATGTCCCCCTTC
GACCAGTCGGGTTTGGGGGCTGAAGAAAGCCTAGGTCTCTTAGATGATTACCTGGAGGTG
GCCAAGCACTTCAAACCTCATGGGTTCTCCAGCGACAAGGCTAAGGCGGGCTCCTCCGAA
TGGCTGGCTGTGGATGGGTTGGTCAGTCCCTCCAACAACAGCAAGGAGGATGCCTTCTCC
GGGACAGATTGGATGTTGGAGAAAATGGATTTGAAGGAGTTCGACTTGGATGCCCTGTTG
GGTATAGATGACCTGGAAACCATGCCAGATGACCTTCTGACCACGTTGGATGACACTTGT
GATCTCTTTGCCCCCCTAGTCCAGGAGACTAATAAGCAGCCCCCCCAGACGGTGAACCCA
ATTGGCCATCTCCCAGAAAGTTTAACAAAACCCGACCAGGTTGCCCCCTTCACCTTCTTA
CAACCTCTTCCCCTTTCCCCAGGGGTCCTGTCCTCCACTCCAGATCATTCCTTTAGTTTA
GAGCTGGGCAGTGAAGTGGATATCACTGAAGGAGATAGGAAGCCAGACTACACTGCTTAC
GTTGCCATGATCCCTCAGTGCATAAAGGAGGAAGACACCCCTTCAGATAATGATAGTGGC
ATCTGTATGAGCCCAGAGTCCTATCTGGGGTCTCCTCAGCACAGCCCCTCTACCAGGGGC
TCTCCAAATAGGAGCCTCCCATCTCCAGGTGTTCTCTGTGGGTCTGCCCGTCCCAAACCT
TACGATCCTCCTGGAGAGAAGATGGTAGCAGCAAAAGTAAAGGGTGAGAAACTGGATAAG
AAGCTGAAAAAAATGGAGCAAAACAAGACAGCAGCCACTAGGTACCGCCAGAAGAAGAGG
GCGGAGCAGGAGGCTCTTACTGGTGAGTGCAAAGAGCTGGAAAAGAAGAACGAGGCTCTA
AAAGAGAGGGCGGATTCCCTGGCCAAGGAGATCCAGTACCTGAAAGATTTGATAGAAGAG
GTCCGCAAGGCAAGGGGGAAGAAAAGGGTCCCC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1233
Start on reference sequence 181
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGTTGGCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : Mach1 T1-R
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ATF4
Symbol Nomenclature : ATF4
SYNONYM : CREB-2; CREB2; TAXREB67; TXREB
Designation : DNA-binding protein TAXREB67|cAMP response element-binding protein 2|cAMP-dependent transcription factor ATF-4|cAMP-responsive element-binding protein 2|cyclic AMP-dependent transcription factor ATF-4|cyclic AMP-responsive element-binding protein 2|tax-responsive enhancer element B67|tax-responsive enhancer element-binding protein 67
Full Nomenclature : activating transcription factor 4
GENEID : 468
GI : 109451601
GenBank Accession : CU013230
HGNC : 786
MIM : 604064
Vega : OTTHUMG00000151099
Target GenBank: CR456384

 

Reference Sequence Alignment

  

HsCD00073588      ATGACCGAAATGAGCTTCCTGAGCAGCGAGGTGTTGGTGGGGGACTTGATGTCCCCCTTC
NM_182810.2       ATGACCGAAATGAGCTTCCTGAGCAGCGAGGTGTTGGTGGGGGACTTGATGTCCCCCTTC
                  ************************************************************

HsCD00073588      GACCAGTCGGGTTTGGGGGCTGAAGAAAGCCTAGGTCTCTTAGATGATTACCTGGAGGTG
NM_182810.2       GACCAGTCGGGTTTGGGGGCTGAAGAAAGCCTAGGTCTCTTAGATGATTACCTGGAGGTG
                  ************************************************************

HsCD00073588      GCCAAGCACTTCAAACCTCATGGGTTCTCCAGCGACAAGGCTAAGGCGGGCTCCTCCGAA
NM_182810.2       GCCAAGCACTTCAAACCTCATGGGTTCTCCAGCGACAAGGCTAAGGCGGGCTCCTCCGAA
                  ************************************************************

HsCD00073588      TGGCTGGCTGTGGATGGGTTGGTCAGTCCCTCCAACAACAGCAAGGAGGATGCCTTCTCC
NM_182810.2       TGGCTGGCTGTGGATGGGTTGGTCAGTCCCTCCAACAACAGCAAGGAGGATGCCTTCTCC
                  ************************************************************

HsCD00073588      GGGACAGATTGGATGTTGGAGAAAATGGATTTGAAGGAGTTCGACTTGGATGCCCTGTTG
NM_182810.2       GGGACAGATTGGATGTTGGAGAAAATGGATTTGAAGGAGTTCGACTTGGATGCCCTGTTG
                  ************************************************************

HsCD00073588      GGTATAGATGACCTGGAAACCATGCCAGATGACCTTCTGACCACGTTGGATGACACTTGT
NM_182810.2       GGTATAGATGACCTGGAAACCATGCCAGATGACCTTCTGACCACGTTGGATGACACTTGT
                  ************************************************************

HsCD00073588      GATCTCTTTGCCCCCCTAGTCCAGGAGACTAATAAGCAGCCCCCCCAGACGGTGAACCCA
NM_182810.2       GATCTCTTTGCCCCCCTAGTCCAGGAGACTAATAAGCAGCCCCCCCAGACGGTGAACCCA
                  ************************************************************

HsCD00073588      ATTGGCCATCTCCCAGAAAGTTTAACAAAACCCGACCAGGTTGCCCCCTTCACCTTCTTA
NM_182810.2       ATTGGCCATCTCCCAGAAAGTTTAACAAAACCCGACCAGGTTGCCCCCTTCACCTTCTTA
                  ************************************************************

HsCD00073588      CAACCTCTTCCCCTTTCCCCAGGGGTCCTGTCCTCCACTCCAGATCATTCCTTTAGTTTA
NM_182810.2       CAACCTCTTCCCCTTTCCCCAGGGGTCCTGTCCTCCACTCCAGATCATTCCTTTAGTTTA
                  ************************************************************

HsCD00073588      GAGCTGGGCAGTGAAGTGGATATCACTGAAGGAGATAGGAAGCCAGACTACACTGCTTAC
NM_182810.2       GAGCTGGGCAGTGAAGTGGATATCACTGAAGGAGATAGGAAGCCAGACTACACTGCTTAC
                  ************************************************************

HsCD00073588      GTTGCCATGATCCCTCAGTGCATAAAGGAGGAAGACACCCCTTCAGATAATGATAGTGGC
NM_182810.2       GTTGCCATGATCCCTCAGTGCATAAAGGAGGAAGACACCCCTTCAGATAATGATAGTGGC
                  ************************************************************

HsCD00073588      ATCTGTATGAGCCCAGAGTCCTATCTGGGGTCTCCTCAGCACAGCCCCTCTACCAGGGGC
NM_182810.2       ATCTGTATGAGCCCAGAGTCCTATCTGGGGTCTCCTCAGCACAGCCCCTCTACCAGGGGC
                  ************************************************************

HsCD00073588      TCTCCAAATAGGAGCCTCCCATCTCCAGGTGTTCTCTGTGGGTCTGCCCGTCCCAAACCT
NM_182810.2       TCTCCAAATAGGAGCCTCCCATCTCCAGGTGTTCTCTGTGGGTCTGCCCGTCCCAAACCT
                  ************************************************************

HsCD00073588      TACGATCCTCCTGGAGAGAAGATGGTAGCAGCAAAAGTAAAGGGTGAGAAACTGGATAAG
NM_182810.2       TACGATCCTCCTGGAGAGAAGATGGTAGCAGCAAAAGTAAAGGGTGAGAAACTGGATAAG
                  ************************************************************

HsCD00073588      AAGCTGAAAAAAATGGAGCAAAACAAGACAGCAGCCACTAGGTACCGCCAGAAGAAGAGG
NM_182810.2       AAGCTGAAAAAAATGGAGCAAAACAAGACAGCAGCCACTAGGTACCGCCAGAAGAAGAGG
                  ************************************************************

HsCD00073588      GCGGAGCAGGAGGCTCTTACTGGTGAGTGCAAAGAGCTGGAAAAGAAGAACGAGGCTCTA
NM_182810.2       GCGGAGCAGGAGGCTCTTACTGGTGAGTGCAAAGAGCTGGAAAAGAAGAACGAGGCTCTA
                  ************************************************************

HsCD00073588      AAAGAGAGGGCGGATTCCCTGGCCAAGGAGATCCAGTACCTGAAAGATTTGATAGAAGAG
NM_182810.2       AAAGAGAGGGCGGATTCCCTGGCCAAGGAGATCCAGTACCTGAAAGATTTGATAGAAGAG
                  ************************************************************

HsCD00073588      GTCCGCAAGGCAAGGGGGAAGAAAAGGGTCCCC---
NM_182810.2       GTCCGCAAGGCAAGGGGGAAGAAAAGGGTCCCCTAG
                  *********************************   

Pathways

NCI : Validated transcriptional targets of AP1 family members Fra1 and Fra2
Panther : Apoptosis signaling pathway
Reactome : ATF4 activates genes
Reactome : ATF6-alpha activates chaperone genes
Reactome : ATF6-alpha activates chaperones
Reactome : Metabolism of proteins
Reactome : PERK regulates gene expression
Reactome : Unfolded Protein Response (UPR)
WikiPathway : MAPK signaling pathway
WikiPathway : Myometrial Relaxation and Contraction Pathways

Protein

SMART domain : BRLZ : basic region leucin zipper
HPRD : 06817

Clone

Cloning Information : 257630
HIP Master Clone ID : 194246
IMAGE ID : 100000010
Original Clone ID : FLH257630.01L

Organism


TAX_ID : 9606
Species Specific ID: 468

Genome

Chromosome : 22
Map Location : 22q13.1
Ensembl : ENSG00000128272

Reagents

Labome : ATF4-antibody