DNASU Plasmid Repository • 480.965.5697 | Email

HIC2 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HIC2
Gene Name:  hypermethylated in cancer 2
Sequence             
Original Clone ID: FLH257679.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00073637

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1848nts         Open reading frame : 1 to 1848
Reference Sequence Alignment

ATGGTGTCTGGGCCCTTGGCACTCCGGTGGTGCGCGTGGGCAGGGCGCGGGGACATGGGG
CCCGACATGGAGCTGCCCAGCCACTCGAAGCAGCTCCTGCTGCAGCTGAACCAGCAGAGG
ACCAAGGGCTTCCTGTGTGACGTCATCATCATGGTGGAGAACTCCATCTTCCGGGCCCAC
AAGAACGTCCTAGCCGCCAGCAGCATCTATTTCAAGTCCCTGGTCCTGCACGACAACCTC
ATCAACCTGGACACAGACATGGTCAGCTCCACAGTGTTCCAGCAGATCTTGGACTTCATC
TACACAGGCAAGCTGCTGCCCAGCGACCAGCCAGCCGAGCCCAACTTCAGCACCCTCCTC
ACTGCCGCCAGCTACCTCCAGCTGCCCGAGTTGGCAGCCCTCTGCCGCCGCAAACTCAAG
CGAGCCGGCAAGCCCTTTGGCTCTGGGAGGGCGGGGTCCACTGGCATGGGGCGGCCCCCC
CGCAGCCAGCGGCTGTCCACGGCCTCTGTCATCCAAGCTCGGTATCAGGGGCTCGTGGAT
GGGCGCAAGGGGGCCCACGCCCCCCAGGAGCTCCCCCAAGCCAAAGGCTCAGACGATGAA
CTCTTTCTTGGTGGCTCTAACCAGGATAGCGTGCAAGGTCTGGGCCGGGCTGTCTGCCCA
GCTGGCGGGGAGGCGGGTCTGGGGGGCTGCAGCAGCAGCACCAACGGGAGCAGCGGGGGC
TGCGAGCAGGAGCTGGGCTTGGACCTGTCCAAGAAAAGCCCACCCTTGCCCCCTGCCACC
CCAGGTCCCCACCTCACTCCCGATGACGCAGCCCAGCTGAGCGACAGCCAACATGGCTCG
CCCCCTGCGGCCTCTGCCCCTCCCGTTGCCAACAGTGCCTCTTATTCTGAGCTGGGGGGC
ACCCCTGATGAGCCCATGGATCTGGAGGGGGCCGAGGACAACCACCTGAGCCTGCTGGAG
GCGCCTGGTGGGCAGCCTCGGAAGAGCCTCCGGCACTCCACTCGGAAGAAGGAGTGGGGC
AAGAAGGAGCCTGTGGCTGGCTCCCCCTTTGAGCGGAGAGAAGCAGGGCCCAAGGGTCCC
TGCCCGGGAGAGGAGGGTGAGGGGGTCGGGGACAGGGTTCCCAATGGCATCCTGGCTAGT
GGGGCTGGCCCTAGCGGGCCCTATGGGGAGCCCCCCTACCCCTGCAAGGAGGAGGAGGAG
AACGGCAAGGATGCAAGTGAAGACAGTGCGCAGAGCGGGAGCGAGGGGGGCAGCGGCCAC
GCCAGCGCCCACTACATGTACCGGCAGGAGGGCTACGAGACGGTGTCCTACGGGGACAAC
TTGTATGTGTGCATTCCCTGCGCCAAGGGCTTCCCCAGCTCTGAGCAGCTCAATGCGCAC
GTGGAGACTCACACGGAGGAAGAGCTGTTCATCAAGGAAGAGGGGGCCTACGAGACAGGC
AGTGGGGGTGCCGAGGAGGAGGCCGAGGACCTGTCAGCACCCAGTGCGGCCTACACGGCT
GAGCCCCGGCCCTTCAAGTGTTCGGTCTGCGAGAAGACCTACAAGGACCCAGCCACGCTG
CGGCAGCACGAGAAGACGCACTGGCTGACACGGCCCTTCCCCTGCAACATCTGTGGCAAA
ATGTTCACGCAGCGCGGCACCATGACGCGTCACATGCGGAGCCACCTGGGCCTGAAGCCC
TTCGCCTGCGATGAGTGTGGCATGCGCTTCACCCGTCAGTACCGCCTCACGGAGCACATG
CGTGTGCACTCGGGCGAGAAACCTTACGAGTGCCAGCTGTGCGGGGGCAAGTTCACCCAG
CAGCGCAACCTCATCAGCCACCTGCGCATGCACACCTCCCCCTCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1954
Start on reference sequence 107
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGTTGGCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : Mach1 T1-R
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HIC2
Symbol Nomenclature : HIC2
SYNONYM : HRG22; ZBTB30; ZNF907
Designation : HIC1-related gene on chromosome 22 protein|hic-2|hic-3|hypermethylated in cancer 2 protein|zinc finger and BTB domain-containing protein 30
Full Nomenclature : hypermethylated in cancer 2
GENEID : 23119
GI : 109451303
GenBank Accession : CU013082
HGNC : 18595
MIM : 607712
Vega : OTTHUMG00000150781
Target GenBank: CR456377

 

Reference Sequence Alignment

  

HsCD00073637        ATGGTGTCTGGGCCCTTGGCACTCCGGTGGTGCGCGTGGGCAGGGCGCGGGGACATGGGG
NM_015094.2         ATGGTGTCTGGGCCCTTGGCACTCCGGTGGTGCGCGTGGGCAGGGCGCGGGGACATGGGG
XM_005261395.1      ATGGTGTCTGGGCCCTTGGCACTCCGGTGGTGCGCGTGGGCAGGGCGCGGGGACATGGGG
                    ************************************************************

HsCD00073637        CCCGACATGGAGCTGCCCAGCCACTCGAAGCAGCTCCTGCTGCAGCTGAACCAGCAGAGG
NM_015094.2         CCCGACATGGAGCTGCCCAGCCACTCGAAGCAGCTCCTGCTGCAGCTGAACCAGCAGAGG
XM_005261395.1      CCCGACATGGAGCTGCCCAGCCACTCGAAGCAGCTCCTGCTGCAGCTGAACCAGCAGAGG
                    ************************************************************

HsCD00073637        ACCAAGGGCTTCCTGTGTGACGTCATCATCATGGTGGAGAACTCCATCTTCCGGGCCCAC
NM_015094.2         ACCAAGGGCTTCCTGTGTGACGTCATCATCATGGTGGAGAACTCCATCTTCCGGGCCCAC
XM_005261395.1      ACCAAGGGCTTCCTGTGTGACGTCATCATCATGGTGGAGAACTCCATCTTCCGGGCCCAC
                    ************************************************************

HsCD00073637        AAGAACGTCCTAGCCGCCAGCAGCATCTATTTCAAGTCCCTGGTCCTGCACGACAACCTC
NM_015094.2         AAGAACGTCCTAGCCGCCAGCAGCATCTATTTCAAGTCCCTGGTCCTGCACGACAACCTC
XM_005261395.1      AAGAACGTCCTAGCCGCCAGCAGCATCTATTTCAAGTCCCTGGTCCTGCACGACAACCTC
                    ************************************************************

HsCD00073637        ATCAACCTGGACACAGACATGGTCAGCTCCACAGTGTTCCAGCAGATCTTGGACTTCATC
NM_015094.2         ATCAACCTGGACACAGACATGGTCAGCTCCACAGTGTTCCAGCAGATCTTGGACTTCATC
XM_005261395.1      ATCAACCTGGACACAGACATGGTCAGCTCCACAGTGTTCCAGCAGATCTTGGACTTCATC
                    ************************************************************

HsCD00073637        TACACAGGCAAGCTGCTGCCCAGCGACCAGCCAGCCGAGCCCAACTTCAGCACCCTCCTC
NM_015094.2         TACACAGGCAAGCTGCTGCCCAGCGACCAGCCAGCCGAGCCCAACTTCAGCACCCTCCTC
XM_005261395.1      TACACAGGCAAGCTGCTGCCCAGCGACCAGCCAGCCGAGCCCAACTTCAGCACCCTCCTC
                    ************************************************************

HsCD00073637        ACTGCCGCCAGCTACCTCCAGCTGCCCGAGTTGGCAGCCCTCTGCCGCCGCAAACTCAAG
NM_015094.2         ACTGCCGCCAGCTACCTCCAGCTGCCCGAGTTGGCAGCCCTCTGCCGCCGCAAACTCAAG
XM_005261395.1      ACTGCCGCCAGCTACCTCCAGCTGCCCGAGTTGGCAGCCCTCTGCCGCCGCAAACTCAAG
                    ************************************************************

HsCD00073637        CGAGCCGGCAAGCCCTTTGGCTCTGGGAGGGCGGGGTCCACTGGCATGGGGCGGCCCCCC
NM_015094.2         CGAGCCGGCAAGCCCTTTGGCTCTGGGAGGGCGGGGTCCACTGGCATGGGGCGGCCCCCC
XM_005261395.1      CGAGCCGGCAAGCCCTTTGGCTCTGGGAGGGCGGGGTCCACTGGCATGGGGCGGCCCCCC
                    ************************************************************

HsCD00073637        CGCAGCCAGCGGCTGTCCACGGCCTCTGTCATCCAAGCTCGGTATCAGGGGCTCGTGGAT
NM_015094.2         CGCAGCCAGCGGCTGTCCACGGCCTCTGTCATCCAAGCTCGGTATCAGGGGCTCGTGGAT
XM_005261395.1      CGCAGCCAGCGGCTGTCCACGGCCTCTGTCATCCAAGCTCGGTATCAGGGGCTCGTGGAT
                    ************************************************************

HsCD00073637        GGGCGCAAGGGGGCCCACGCCCCCCAGGAGCTCCCCCAAGCCAAAGGCTCAGACGATGAA
NM_015094.2         GGGCGCAAGGGGGCCCACGCCCCCCAGGAGCTCCCCCAAGCCAAAGGCTCAGACGATGAA
XM_005261395.1      GGGCGCAAGGGGGCCCACGCCCCCCAGGAGCTCCCCCAAGCCAAAGGCTCAGACGATGAA
                    ************************************************************

HsCD00073637        CTCTTTCTTGGTGGCTCTAACCAGGATAGCGTGCAAGGTCTGGGCCGGGCTGTCTGCCCA
NM_015094.2         CTCTTTCTTGGTGGCTCTAACCAGGATAGCGTGCAAGGTCTGGGCCGGGCTGTCTGCCCA
XM_005261395.1      CTCTTTCTTGGTGGCTCTAACCAGGATAGCGTGCAAGGTCTGGGCCGGGCTGTCTGCCCA
                    ************************************************************

HsCD00073637        GCTGGCGGGGAGGCGGGTCTGGGGGGCTGCAGCAGCAGCACCAACGGGAGCAGCGGGGGC
NM_015094.2         GCTGGCGGGGAGGCGGGTCTGGGGGGCTGCAGCAGCAGCACCAACGGGAGCAGCGGGGGC
XM_005261395.1      GCTGGCGGGGAGGCGGGTCTGGGGGGCTGCAGCAGCAGCACCAACGGGAGCAGCGGGGGC
                    ************************************************************

HsCD00073637        TGCGAGCAGGAGCTGGGCTTGGACCTGTCCAAGAAAAGCCCACCCTTGCCCCCTGCCACC
NM_015094.2         TGCGAGCAGGAGCTGGGCTTGGACCTGTCCAAGAAAAGCCCACCCTTGCCCCCTGCCACC
XM_005261395.1      TGCGAGCAGGAGCTGGGCTTGGACCTGTCCAAGAAAAGCCCACCCTTGCCCCCTGCCACC
                    ************************************************************

HsCD00073637        CCAGGTCCCCACCTCACTCCCGATGACGCAGCCCAGCTGAGCGACAGCCAACATGGCTCG
NM_015094.2         CCAGGTCCCCACCTCACTCCCGATGACGCAGCCCAGCTGAGCGACAGCCAACATGGCTCG
XM_005261395.1      CCAGGTCCCCACCTCACTCCCGATGACGCAGCCCAGCTGAGCGACAGCCAACATGGCTCG
                    ************************************************************

HsCD00073637        CCCCCTGCGGCCTCTGCCCCTCCCGTTGCCAACAGTGCCTCTTATTCTGAGCTGGGGGGC
NM_015094.2         CCCCCTGCGGCCTCTGCTCCTCCCGTTGCCAACAGTGCCTCTTATTCTGAGCTGGGGGGC
XM_005261395.1      CCCCCTGCGGCCTCTGCTCCTCCCGTTGCCAACAGTGCCTCTTATTCTGAGCTGGGGGGC
                    ***************** ******************************************

HsCD00073637        ACCCCTGATGAGCCCATGGATCTGGAGGGGGCCGAGGACAACCACCTGAGCCTGCTGGAG
NM_015094.2         ACCCCTGATGAGCCCATGGATCTGGAGGGGGCCGAGGACAACCACCTGAGCCTGCTGGAG
XM_005261395.1      ACCCCTGATGAGCCCATGGATCTGGAGGGGGCCGAGGACAACCACCTGAGCCTGCTGGAG
                    ************************************************************

HsCD00073637        GCGCCTGGTGGGCAGCCTCGGAAGAGCCTCCGGCACTCCACTCGGAAGAAGGAGTGGGGC
NM_015094.2         GCGCCTGGTGGGCAGCCTCGGAAGAGCCTCCGGCACTCCACTCGGAAGAAGGAGTGGGGC
XM_005261395.1      GCGCCTGGTGGGCAGCCTCGGAAGAGCCTCCGGCACTCCACTCGGAAGAAGGAGTGGGGC
                    ************************************************************

HsCD00073637        AAGAAGGAGCCTGTGGCTGGCTCCCCCTTTGAGCGGAGAGAAGCAGGGCCCAAGGGTCCC
NM_015094.2         AAGAAGGAGCCTGTGGCTGGCTCCCCCTTTGAGCGGAGAGAAGCAGGGCCCAAGGGTCCC
XM_005261395.1      AAGAAGGAGCCTGTGGCTGGCTCCCCCTTTGAGCGGAGAGAAGCAGGGCCCAAGGGTCCC
                    ************************************************************

HsCD00073637        TGCCCGGGAGAGGAGGGTGAGGGGGTCGGGGACAGGGTTCCCAATGGCATCCTGGCTAGT
NM_015094.2         TGCCCGGGAGAGGAGGGTGAGGGGGTCGGGGACAGGGTTCCCAATGGCATCCTGGCTAGT
XM_005261395.1      TGCCCGGGAGAGGAGGGTGAGGGGGTCGGGGACAGGGTTCCCAATGGCATCCTGGCTAGT
                    ************************************************************

HsCD00073637        GGGGCTGGCCCTAGCGGGCCCTATGGGGAGCCCCCCTACCCCTGCAAGGAGGAGGAGGAG
NM_015094.2         GGGGCTGGCCCTAGCGGGCCCTATGGGGAGCCCCCCTACCCCTGCAAGGAGGAGGAGGAG
XM_005261395.1      GGGGCTGGCCCTAGCGGGCCCTATGGGGAGCCCCCCTACCCCTGCAAGGAGGAGGAGGAG
                    ************************************************************

HsCD00073637        AACGGCAAGGATGCAAGTGAAGACAGTGCGCAGAGCGGGAGCGAGGGGGGCAGCGGCCAC
NM_015094.2         AACGGCAAGGATGCAAGTGAAGACAGTGCGCAGAGCGGGAGCGAGGGGGGCAGCGGCCAT
XM_005261395.1      AACGGCAAGGATGCAAGTGAAGACAGTGCGCAGAGCGGGAGCGAGGGGGGCAGCGGCCAT
                    *********************************************************** 

HsCD00073637        GCCAGCGCCCACTACATGTACCGGCAGGAGGGCTACGAGACGGTGTCCTACGGGGACAAC
NM_015094.2         GCCAGCGCCCACTACATGTACCGGCAGGAGGGCTACGAGACGGTGTCCTACGGGGACAAC
XM_005261395.1      GCCAGCGCCCACTACATGTACCGGCAGGAGGGCTACGAGACGGTGTCCTACGGGGACAAC
                    ************************************************************

HsCD00073637        TTGTATGTGTGCATTCCCTGCGCCAAGGGCTTCCCCAGCTCTGAGCAGCTCAATGCGCAC
NM_015094.2         TTGTATGTGTGCATTCCCTGCGCCAAGGGCTTCCCCAGCTCTGAGCAGCTCAATGCGCAC
XM_005261395.1      TTGTATGTGTGCATTCCCTGCGCCAAGGGCTTCCCCAGCTCTGAGCAGCTCAATGCGCAC
                    ************************************************************

HsCD00073637        GTGGAGACTCACACGGAGGAAGAGCTGTTCATCAAGGAAGAGGGGGCCTACGAGACAGGC
NM_015094.2         GTGGAGACTCACACGGAGGAAGAGCTGTTCATCAAGGAAGAGGGGGCCTACGAGACAGGC
XM_005261395.1      GTGGAGACTCACACGGAGGAAGAGCTGTTCATCAAGGAAGAGGGGGCCTACGAGACAGGC
                    ************************************************************

HsCD00073637        AGTGGGGGTGCCGAGGAGGAGGCCGAGGACCTGTCAGCACCCAGTGCGGCCTACACGGCT
NM_015094.2         AGTGGGGGTGCCGAGGAGGAGGCCGAGGACCTGTCAGCACCCAGTGCGGCCTACACGGCT
XM_005261395.1      AGTGGGGGTGCCGAGGAGGAGGCCGAGGACCTGTCAGCACCCAGTGCGGCCTACACGGCT
                    ************************************************************

HsCD00073637        GAGCCCCGGCCCTTCAAGTGTTCGGTCTGCGAGAAGACCTACAAGGACCCAGCCACGCTG
NM_015094.2         GAGCCCCGGCCCTTCAAGTGTTCGGTCTGCGAGAAGACCTACAAGGACCCAGCCACGCTG
XM_005261395.1      GAGCCCCGGCCCTTCAAGTGTTCGGTCTGCGAGAAGACCTACAAGGACCCAGCCACGCTG
                    ************************************************************

HsCD00073637        CGGCAGCACGAGAAGACGCACTGGCTGACACGGCCCTTCCCCTGCAACATCTGTGGCAAA
NM_015094.2         CGGCAGCACGAGAAGACGCACTGGCTGACACGGCCCTTCCCCTGCAACATCTGTGGCAAA
XM_005261395.1      CGGCAGCACGAGAAGACGCACTGGCTGACACGGCCCTTCCCCTGCAACATCTGTGGCAAA
                    ************************************************************

HsCD00073637        ATGTTCACGCAGCGCGGCACCATGACGCGTCACATGCGGAGCCACCTGGGCCTGAAGCCC
NM_015094.2         ATGTTCACGCAGCGCGGCACCATGACGCGTCACATGCGGAGCCACCTGGGCCTGAAGCCC
XM_005261395.1      ATGTTCACGCAGCGCGGCACCATGACGCGTCACATGCGGAGCCACCTGGGCCTGAAGCCC
                    ************************************************************

HsCD00073637        TTCGCCTGCGATGAGTGTGGCATGCGCTTCACCCGTCAGTACCGCCTCACGGAGCACATG
NM_015094.2         TTCGCCTGCGATGAGTGTGGCATGCGCTTCACCCGTCAGTACCGCCTCACGGAGCACATG
XM_005261395.1      TTCGCCTGCGATGAGTGTGGCATGCGCTTCACCCGTCAGTACCGCCTCACGGAGCACATG
                    ************************************************************

HsCD00073637        CGTGTGCACTCGGGCGAGAAACCTTACGAGTGCCAGCTGTGCGGGGGCAAGTTCACCCAG
NM_015094.2         CGTGTGCACTCGGGCGAGAAACCTTACGAGTGCCAGCTGTGCGGGGGCAAGTTCACCCAG
XM_005261395.1      CGTGTGCACTCGGGCGAGAAACCTTACGAGTGCCAGCTGTGCGGGGGCAAGTTCACCCAG
                    ************************************************************

HsCD00073637        CAGCGCAACCTCATCAGCCACCTGCGCATGCACACCTCCCCCTCCTAG
NM_015094.2         CAGCGCAACCTCATCAGCCACCTGCGCATGCACACCTCCCCCTCCTAG
XM_005261395.1      CAGCGCAACCTCATCAGCCACCTGCGCATGCACACCTCCCCCTCCTAG
                    ************************************************

Protein

SMART domain : BTB : Broad-Complex, Tramtrack and Bric a brac
SMART domain : ZnF_C2H2 : zinc finger
UniProt : Q96JB3
HPRD : 07412

Clone

Cloning Information : 257679
HIP Master Clone ID : 194295
IMAGE ID : 100000341
Original Clone ID : FLH257679.01X

Organism


TAX_ID : 9606
Species Specific ID: 23119

Genome

Chromosome : 22
Map Location : 22q11.21
Ensembl : ENSG00000169635

Reagents

Labome : HIC2-antibody