DNASU Plasmid Repository • 480.965.5697 | Email

IL2RB (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IL2RB
Gene Name:  interleukin 2 receptor, beta
Sequence             
Original Clone ID: FLH257833.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00073791

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1653nts         Open reading frame : 1 to 1653
Reference Sequence Alignment

ATGGCGGCCCCTGCTCTGTCCTGGCGTCTGCCCCTCCTCATCCTCCTCCTGCCCCTGGCT
ACCTCTTGGGCATCTGCAGCGGTGAATGGCACTTCCCAGTTCACATGCTTCTACAACTCG
AGAGCCAACATCTCCTGTGTCTGGAGCCAAGATGGGGCTCTGCAGGACACTTCCTGCCAA
GTCCATGCCTGGCCGGACAGACGGCGGTGGAACCAAACCTGTGAGCTGCTCCCCGTGAGT
CAAGCATCCTGGGCCTGCAACCTGATCCTCGGAGCCCCAGATTCTCAGAAACTGACCACA
GTTGACATCGTCACCCTGAGGGTGCTGTGCCGTGAGGGGGTGCGATGGAGGGTGATGGCC
ATCCAGGACTTCAAGCCCTTTGAGAACCTTCGCCTGATGGCCCCCATCTCCCTCCAAGTT
GTCCACGTGGAGACCCACAGATGCAACATAAGCTGGGAAATCTCCCAAGCCTCCCACTAC
TTTGAAAGACACCTGGAGTTCGAGGCCCGGACGCTGTCCCCAGGCCACACCTGGGAGGAG
GCCCCCCTGCTGACTCTCAAGCAGAAGCAGGAATGGATCTGCCTGGAGACGCTCACCCCA
GACACCCAGTATGAGTTTCAGGTGCGGGTCAAGCCTCTGCAAGGCGAGTTCACGACCTGG
AGCCCCTGGAGCCAGCCCCTGGCCTTCAGGACAAAGCCTGCAGCCCTTGGGAAGGACACC
ATTCCGTGGCTCGGCCACCTCCTCGTGGGCCTCAGCGGGGCTTTTGGCTTCATCATCTTA
GTGTACTTGCTGATCAACTGCAGGAACACCGGGCCATGGCTGAAGAAGGTCCTGAAGTGT
AACACCCCAGACCCCTCGAAGTTCTTTTCCCAGCTGAGCTCAGAGCATGGAGGAGACGTC
CAGAAGTGGCTCTCTTCGCCCTTCCCCTCATCGTCCTTCAGCCCTGGCGGCCTGGCACCT
GAGATCTCGCCACTAGAAGTGCTGGAGAGGGACAAGGTGACGCAGCTGCTCCTGCAGCAG
GACAAGGTGCCTGAGCCCGCATCCTTAAGCAGCAACCACTCGCTGACCAGCTGCTTCACC
AACCAGGGTTACTTCTTCTTCCACCTCCCGGATGCCTTGGAGATAGAGGCCTGCCAGGTG
TACTTTACTTACGACCCCTACTCAGAGGAAGACCCTGATGAGGGTGTGGCCGGGGCACCC
ACAGGGTCTTCCCCCCAACCCCTGCAGCCTCTGTCAGGGGAGGACGACGCCTACTGCACC
TTCCCCTCCAGGGATGACCTGCTGCTCTTCTCCCCCAGTCTCCTCGGTGGCCCCAGCCCC
CCAAGCACTGCCCCTGGGGGCAGTGGGGCCGGTGAAGAGAGGATGCCCCCTTCTTTGCAA
GAAAGAGTCCCCAGAGACTGGGACCCCCAGCCCCTGGGGCCTCCCACCCCAGGAGTCCCA
GACCTGGTGGATTTTCAGCCACCCCCTGAGCTGGTGCTGCGAGAGGCTGGGGAGGAGGTC
CCTGACGCTGGCCCCAGGGAGGGAGTCAGTTTCCCCTGGTCCAGGCCTCCTGGGCAGGGG
GAGTTCAGGGCCCTTAATGCTCGCCTGCCCCTGAACACTGATGCCTACTTGTCCCTCCAA
GAACTCCAGGGTCAGGACCCAACTCACTTGGTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1672
Start on reference sequence 20
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGTTGGCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : Mach1 T1-R
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IL2RB
Symbol Nomenclature : IL2RB
SYNONYM : CD122; IL15RB; P70-75
Designation : CD122 antigen|IL-2 receptor subunit beta|IL-2R subunit beta|IL-2RB|high affinity IL-2 receptor beta subunit|high affinity IL-2 receptor subunit beta|interleukin 15 receptor, beta|interleukin-2 receptor subunit beta|p75
Full Nomenclature : interleukin 2 receptor, beta
GENEID : 3560
Locus Tag : RP5-1170K4.6
GI : 109451925
GenBank Accession : CU013392
HGNC : 6009
MIM : 146710
Vega : OTTHUMG00000150534
Target GenBank: CR456506

 

Reference Sequence Alignment

  

HsCD00073791      ATGGCGGCCCCTGCTCTGTCCTGGCGTCTGCCCCTCCTCATCCTCCTCCTGCCCCTGGCT
NM_000878.3       ATGGCGGCCCCTGCTCTGTCCTGGCGTCTGCCCCTCCTCATCCTCCTCCTGCCCCTGGCT
                  ************************************************************

HsCD00073791      ACCTCTTGGGCATCTGCAGCGGTGAATGGCACTTCCCAGTTCACATGCTTCTACAACTCG
NM_000878.3       ACCTCTTGGGCATCTGCAGCGGTGAATGGCACTTCCCAGTTCACATGCTTCTACAACTCG
                  ************************************************************

HsCD00073791      AGAGCCAACATCTCCTGTGTCTGGAGCCAAGATGGGGCTCTGCAGGACACTTCCTGCCAA
NM_000878.3       AGAGCCAACATCTCCTGTGTCTGGAGCCAAGATGGGGCTCTGCAGGACACTTCCTGCCAA
                  ************************************************************

HsCD00073791      GTCCATGCCTGGCCGGACAGACGGCGGTGGAACCAAACCTGTGAGCTGCTCCCCGTGAGT
NM_000878.3       GTCCATGCCTGGCCGGACAGACGGCGGTGGAACCAAACCTGTGAGCTGCTCCCCGTGAGT
                  ************************************************************

HsCD00073791      CAAGCATCCTGGGCCTGCAACCTGATCCTCGGAGCCCCAGATTCTCAGAAACTGACCACA
NM_000878.3       CAAGCATCCTGGGCCTGCAACCTGATCCTCGGAGCCCCAGATTCTCAGAAACTGACCACA
                  ************************************************************

HsCD00073791      GTTGACATCGTCACCCTGAGGGTGCTGTGCCGTGAGGGGGTGCGATGGAGGGTGATGGCC
NM_000878.3       GTTGACATCGTCACCCTGAGGGTGCTGTGCCGTGAGGGGGTGCGATGGAGGGTGATGGCC
                  ************************************************************

HsCD00073791      ATCCAGGACTTCAAGCCCTTTGAGAACCTTCGCCTGATGGCCCCCATCTCCCTCCAAGTT
NM_000878.3       ATCCAGGACTTCAAGCCCTTTGAGAACCTTCGCCTGATGGCCCCCATCTCCCTCCAAGTT
                  ************************************************************

HsCD00073791      GTCCACGTGGAGACCCACAGATGCAACATAAGCTGGGAAATCTCCCAAGCCTCCCACTAC
NM_000878.3       GTCCACGTGGAGACCCACAGATGCAACATAAGCTGGGAAATCTCCCAAGCCTCCCACTAC
                  ************************************************************

HsCD00073791      TTTGAAAGACACCTGGAGTTCGAGGCCCGGACGCTGTCCCCAGGCCACACCTGGGAGGAG
NM_000878.3       TTTGAAAGACACCTGGAGTTCGAGGCCCGGACGCTGTCCCCAGGCCACACCTGGGAGGAG
                  ************************************************************

HsCD00073791      GCCCCCCTGCTGACTCTCAAGCAGAAGCAGGAATGGATCTGCCTGGAGACGCTCACCCCA
NM_000878.3       GCCCCCCTGCTGACTCTCAAGCAGAAGCAGGAATGGATCTGCCTGGAGACGCTCACCCCA
                  ************************************************************

HsCD00073791      GACACCCAGTATGAGTTTCAGGTGCGGGTCAAGCCTCTGCAAGGCGAGTTCACGACCTGG
NM_000878.3       GACACCCAGTATGAGTTTCAGGTGCGGGTCAAGCCTCTGCAAGGCGAGTTCACGACCTGG
                  ************************************************************

HsCD00073791      AGCCCCTGGAGCCAGCCCCTGGCCTTCAGGACAAAGCCTGCAGCCCTTGGGAAGGACACC
NM_000878.3       AGCCCCTGGAGCCAGCCCCTGGCCTTCAGGACAAAGCCTGCAGCCCTTGGGAAGGACACC
                  ************************************************************

HsCD00073791      ATTCCGTGGCTCGGCCACCTCCTCGTGGGCCTCAGCGGGGCTTTTGGCTTCATCATCTTA
NM_000878.3       ATTCCGTGGCTCGGCCACCTCCTCGTGGGCCTCAGCGGGGCTTTTGGCTTCATCATCTTA
                  ************************************************************

HsCD00073791      GTGTACTTGCTGATCAACTGCAGGAACACCGGGCCATGGCTGAAGAAGGTCCTGAAGTGT
NM_000878.3       GTGTACTTGCTGATCAACTGCAGGAACACCGGGCCATGGCTGAAGAAGGTCCTGAAGTGT
                  ************************************************************

HsCD00073791      AACACCCCAGACCCCTCGAAGTTCTTTTCCCAGCTGAGCTCAGAGCATGGAGGAGACGTC
NM_000878.3       AACACCCCAGACCCCTCGAAGTTCTTTTCCCAGCTGAGCTCAGAGCATGGAGGAGACGTC
                  ************************************************************

HsCD00073791      CAGAAGTGGCTCTCTTCGCCCTTCCCCTCATCGTCCTTCAGCCCTGGCGGCCTGGCACCT
NM_000878.3       CAGAAGTGGCTCTCTTCGCCCTTCCCCTCATCGTCCTTCAGCCCTGGCGGCCTGGCACCT
                  ************************************************************

HsCD00073791      GAGATCTCGCCACTAGAAGTGCTGGAGAGGGACAAGGTGACGCAGCTGCTCCTGCAGCAG
NM_000878.3       GAGATCTCGCCACTAGAAGTGCTGGAGAGGGACAAGGTGACGCAGCTGCTCCTGCAGCAG
                  ************************************************************

HsCD00073791      GACAAGGTGCCTGAGCCCGCATCCTTAAGCAGCAACCACTCGCTGACCAGCTGCTTCACC
NM_000878.3       GACAAGGTGCCTGAGCCCGCATCCTTAAGCAGCAACCACTCGCTGACCAGCTGCTTCACC
                  ************************************************************

HsCD00073791      AACCAGGGTTACTTCTTCTTCCACCTCCCGGATGCCTTGGAGATAGAGGCCTGCCAGGTG
NM_000878.3       AACCAGGGTTACTTCTTCTTCCACCTCCCGGATGCCTTGGAGATAGAGGCCTGCCAGGTG
                  ************************************************************

HsCD00073791      TACTTTACTTACGACCCCTACTCAGAGGAAGACCCTGATGAGGGTGTGGCCGGGGCACCC
NM_000878.3       TACTTTACTTACGACCCCTACTCAGAGGAAGACCCTGATGAGGGTGTGGCCGGGGCACCC
                  ************************************************************

HsCD00073791      ACAGGGTCTTCCCCCCAACCCCTGCAGCCTCTGTCAGGGGAGGACGACGCCTACTGCACC
NM_000878.3       ACAGGGTCTTCCCCCCAACCCCTGCAGCCTCTGTCAGGGGAGGACGACGCCTACTGCACC
                  ************************************************************

HsCD00073791      TTCCCCTCCAGGGATGACCTGCTGCTCTTCTCCCCCAGTCTCCTCGGTGGCCCCAGCCCC
NM_000878.3       TTCCCCTCCAGGGATGACCTGCTGCTCTTCTCCCCCAGTCTCCTCGGTGGCCCCAGCCCC
                  ************************************************************

HsCD00073791      CCAAGCACTGCCCCTGGGGGCAGTGGGGCCGGTGAAGAGAGGATGCCCCCTTCTTTGCAA
NM_000878.3       CCAAGCACTGCCCCTGGGGGCAGTGGGGCCGGTGAAGAGAGGATGCCCCCTTCTTTGCAA
                  ************************************************************

HsCD00073791      GAAAGAGTCCCCAGAGACTGGGACCCCCAGCCCCTGGGGCCTCCCACCCCAGGAGTCCCA
NM_000878.3       GAAAGAGTCCCCAGAGACTGGGACCCCCAGCCCCTGGGGCCTCCCACCCCAGGAGTCCCA
                  ************************************************************

HsCD00073791      GACCTGGTGGATTTTCAGCCACCCCCTGAGCTGGTGCTGCGAGAGGCTGGGGAGGAGGTC
NM_000878.3       GACCTGGTGGATTTTCAGCCACCCCCTGAGCTGGTGCTGCGAGAGGCTGGGGAGGAGGTC
                  ************************************************************

HsCD00073791      CCTGACGCTGGCCCCAGGGAGGGAGTCAGTTTCCCCTGGTCCAGGCCTCCTGGGCAGGGG
NM_000878.3       CCTGACGCTGGCCCCAGGGAGGGAGTCAGTTTCCCCTGGTCCAGGCCTCCTGGGCAGGGG
                  ************************************************************

HsCD00073791      GAGTTCAGGGCCCTTAATGCTCGCCTGCCCCTGAACACTGATGCCTACTTGTCCCTCCAA
NM_000878.3       GAGTTCAGGGCCCTTAATGCTCGCCTGCCCCTGAACACTGATGCCTACTTGTCCCTCCAA
                  ************************************************************

HsCD00073791      GAACTCCAGGGTCAGGACCCAACTCACTTGGTG---
NM_000878.3       GAACTCCAGGGTCAGGACCCAACTCACTTGGTGTAG
                  *********************************   

Pathways

NCI : Downstream signaling in naïve CD8+ T cells
NCI : IL12-mediated signaling events
NCI : IL2 signaling events mediated by PI3K
NCI : IL2 signaling events mediated by STAT5
NCI : IL2-mediated signaling events
NCI : SHP2 signaling
Panther : Interleukin signaling pathway
Reactome : Cytokine Signaling in Immune system
Reactome : Immune System
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Signaling by Interleukins
WikiPathway : IL-2 Signaling pathway
WikiPathway : Inflammatory Response Pathway

Protein

SMART domain : FN3 : Fibronectin type 3 domain
HPRD : 00896

Clone

Cloning Information : 257833
HIP Master Clone ID : 194449
IMAGE ID : 100000267
Original Clone ID : FLH257833.01L

Organism


TAX_ID : 9606
Species Specific ID: 3560

Genome

Chromosome : 22
Map Location : 22q13.1
Ensembl : ENSG00000100385

Reagents

Labome : IL2RB-antibody